GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-13 10:40:26, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_031804                 95 bp    RNA     linear   ROD 12-AUG-2025
DEFINITION  Rattus norvegicus microRNA let-7a-3 (Mirlet7c-2), microRNA.
ACCESSION   NR_031804
VERSION     NR_031804.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 95)
  AUTHORS   Gu,Q.H., Yu,D., Hu,Z., Liu,X., Yang,Y., Luo,Y., Zhu,J. and Li,Z.
  TITLE     miR-26a and miR-384-5p are required for LTP maintenance and spine
            enlargement
  JOURNAL   Nat Commun 6, 6789 (2015)
   PUBMED   25858512
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 95)
  AUTHORS   Kim,J.M., Lee,S.T., Chu,K., Jung,K.H., Kim,J.H., Yu,J.S., Kim,S.,
            Kim,S.H., Park,D.K., Moon,J., Ban,J., Kim,M., Lee,S.K. and Roh,J.K.
  TITLE     Inhibition of Let7c microRNA is neuroprotective in a rat
            intracerebral hemorrhage model
  JOURNAL   PLoS One 9 (6), e97946 (2014)
   PUBMED   24959881
  REMARK    GeneRIF: Results showed that Let-7c2 was up-regulated in rat model
            of intracerebral hemorrhage and its inhibition enhanced
            neurological recovery.
            Erratum:[PLoS One. 2014;9(7):e104465]
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 95)
  AUTHORS   Polikepahad,S. and Corry,D.B.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   4  (bases 1 to 95)
  AUTHORS   Repetto,E., Briata,P., Kuziner,N., Harfe,B.D., McManus,M.T.,
            Gherzi,R., Rosenfeld,M.G. and Trabucchi,M.
  TITLE     Let-7b/c enhance the stability of a tissue-specific mRNA during
            mammalian organogenesis as part of a feedback loop involving KSRP
  JOURNAL   PLoS Genet 8 (7), e1002823 (2012)
   PUBMED   22844247
  REMARK    Erratum:[PLoS Genet. 2012 Sep;8(9).
            doi:10.1371/annotation/c93e4b67-d237-48fb-aec7-0db398407bb4]
REFERENCE   5  (bases 1 to 95)
  AUTHORS   Linsen,S.E., de Wit,E., de Bruijn,E. and Cuppen,E.
  TITLE     Small RNA expression and strain specificity in the rat
  JOURNAL   BMC Genomics 11, 249 (2010)
   PUBMED   20403161
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 95)
  AUTHORS   Watanabe,T., Takeda,A., Tsukiyama,T., Mise,K., Okuno,T., Sasaki,H.,
            Minami,N. and Imai,H.
  TITLE     Identification and characterization of two novel classes of small
            RNAs in the mouse germline: retrotransposon-derived siRNAs in
            oocytes and germline small RNAs in testes
  JOURNAL   Genes Dev 20 (13), 1732-1743 (2006)
   PUBMED   16766679
REFERENCE   7  (bases 1 to 95)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   8  (bases 1 to 95)
  AUTHORS   Mansfield,J.H., Harfe,B.D., Nissen,R., Obenauer,J., Srineel,J.,
            Chaudhuri,A., Farzan-Kashani,R., Zuker,M., Pasquinelli,A.E.,
            Ruvkun,G., Sharp,P.A., Tabin,C.J. and McManus,M.T.
  TITLE     MicroRNA-responsive 'sensor' transgenes uncover Hox-like and other
            developmentally regulated patterns of vertebrate microRNA
            expression
  JOURNAL   Nat Genet 36 (10), 1079-1083 (2004)
   PUBMED   15361871
  REMARK    Erratum:[Nat Genet. 2004 Nov;36(11):1238]
REFERENCE   9  (bases 1 to 95)
  AUTHORS   Kim,J., Krichevsky,A., Grad,Y., Hayes,G.D., Kosik,K.S., Church,G.M.
            and Ruvkun,G.
  TITLE     Identification of many microRNAs that copurify with polyribosomes
            in mammalian neurons
  JOURNAL   Proc Natl Acad Sci U S A 101 (1), 360-365 (2004)
   PUBMED   14691248
REFERENCE   10 (bases 1 to 95)
  AUTHORS   Miska,E.A., Alvarez-Saavedra,E., Townsend,M., Yoshii,A., Sestan,N.,
            Rakic,P., Constantine-Paton,M. and Horvitz,H.R.
  TITLE     Microarray analysis of microRNA expression in the developing
            mammalian brain
  JOURNAL   Genome Biol 5 (9), R68 (2004)
   PUBMED   15345052
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JAXUCZ010000007.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: SRR26360186.116714.1,
                                        SRR22582419.238073.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-95                JAXUCZ010000007.1  118683623-118683717
FEATURES             Location/Qualifiers
     source          1..95
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="7"
                     /map="7q34"
     gene            1..95
                     /gene="Mirlet7c-2"
                     /gene_synonym="Mirlet7c2; rno-let-7c-2"
                     /note="microRNA let-7a-3"
                     /db_xref="GeneID:100314224"
                     /db_xref="miRBase:MI0000831"
                     /db_xref="RGD:2325399"
     precursor_RNA   1..95
                     /gene="Mirlet7c-2"
                     /gene_synonym="Mirlet7c2; rno-let-7c-2"
                     /product="microRNA let-7a-3"
                     /db_xref="GeneID:100314224"
                     /db_xref="miRBase:MI0000831"
                     /db_xref="RGD:2325399"
     exon            1..95
                     /gene="Mirlet7c-2"
                     /gene_synonym="Mirlet7c2; rno-let-7c-2"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           14..35
                     /ncRNA_class="miRNA"
                     /gene="Mirlet7c-2"
                     /gene_synonym="Mirlet7c2; rno-let-7c-2"
                     /product="rno-let-7c-5p"
                     /db_xref="miRBase:MIMAT0000776"
                     /db_xref="GeneID:100314224"
                     /db_xref="miRBase:MI0000831"
                     /db_xref="RGD:2325399"
     ncRNA           62..83
                     /ncRNA_class="miRNA"
                     /gene="Mirlet7c-2"
                     /gene_synonym="Mirlet7c2; rno-let-7c-2"
                     /product="rno-let-7c-2-3p"
                     /db_xref="miRBase:MIMAT0017088"
                     /db_xref="GeneID:100314224"
                     /db_xref="miRBase:MI0000831"
                     /db_xref="RGD:2325399"
ORIGIN      
acggcctttggggtgaggtagtaggttgtatggttttgggctctgccccgctctgcggtaactatacaatctactgtctttcctgaagtggccgc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]