ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-13 10:40:26, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_031804 95 bp RNA linear ROD 12-AUG-2025
DEFINITION Rattus norvegicus microRNA let-7a-3 (Mirlet7c-2), microRNA.
ACCESSION NR_031804
VERSION NR_031804.1
KEYWORDS RefSeq.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 95)
AUTHORS Gu,Q.H., Yu,D., Hu,Z., Liu,X., Yang,Y., Luo,Y., Zhu,J. and Li,Z.
TITLE miR-26a and miR-384-5p are required for LTP maintenance and spine
enlargement
JOURNAL Nat Commun 6, 6789 (2015)
PUBMED 25858512
REMARK Publication Status: Online-Only
REFERENCE 2 (bases 1 to 95)
AUTHORS Kim,J.M., Lee,S.T., Chu,K., Jung,K.H., Kim,J.H., Yu,J.S., Kim,S.,
Kim,S.H., Park,D.K., Moon,J., Ban,J., Kim,M., Lee,S.K. and Roh,J.K.
TITLE Inhibition of Let7c microRNA is neuroprotective in a rat
intracerebral hemorrhage model
JOURNAL PLoS One 9 (6), e97946 (2014)
PUBMED 24959881
REMARK GeneRIF: Results showed that Let-7c2 was up-regulated in rat model
of intracerebral hemorrhage and its inhibition enhanced
neurological recovery.
Erratum:[PLoS One. 2014;9(7):e104465]
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 95)
AUTHORS Polikepahad,S. and Corry,D.B.
TITLE Profiling of T helper cell-derived small RNAs reveals unique
antisense transcripts and differential association of miRNAs with
argonaute proteins 1 and 2
JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013)
PUBMED 23185045
REFERENCE 4 (bases 1 to 95)
AUTHORS Repetto,E., Briata,P., Kuziner,N., Harfe,B.D., McManus,M.T.,
Gherzi,R., Rosenfeld,M.G. and Trabucchi,M.
TITLE Let-7b/c enhance the stability of a tissue-specific mRNA during
mammalian organogenesis as part of a feedback loop involving KSRP
JOURNAL PLoS Genet 8 (7), e1002823 (2012)
PUBMED 22844247
REMARK Erratum:[PLoS Genet. 2012 Sep;8(9).
doi:10.1371/annotation/c93e4b67-d237-48fb-aec7-0db398407bb4]
REFERENCE 5 (bases 1 to 95)
AUTHORS Linsen,S.E., de Wit,E., de Bruijn,E. and Cuppen,E.
TITLE Small RNA expression and strain specificity in the rat
JOURNAL BMC Genomics 11, 249 (2010)
PUBMED 20403161
REMARK Publication Status: Online-Only
REFERENCE 6 (bases 1 to 95)
AUTHORS Watanabe,T., Takeda,A., Tsukiyama,T., Mise,K., Okuno,T., Sasaki,H.,
Minami,N. and Imai,H.
TITLE Identification and characterization of two novel classes of small
RNAs in the mouse germline: retrotransposon-derived siRNAs in
oocytes and germline small RNAs in testes
JOURNAL Genes Dev 20 (13), 1732-1743 (2006)
PUBMED 16766679
REFERENCE 7 (bases 1 to 95)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
REFERENCE 8 (bases 1 to 95)
AUTHORS Mansfield,J.H., Harfe,B.D., Nissen,R., Obenauer,J., Srineel,J.,
Chaudhuri,A., Farzan-Kashani,R., Zuker,M., Pasquinelli,A.E.,
Ruvkun,G., Sharp,P.A., Tabin,C.J. and McManus,M.T.
TITLE MicroRNA-responsive 'sensor' transgenes uncover Hox-like and other
developmentally regulated patterns of vertebrate microRNA
expression
JOURNAL Nat Genet 36 (10), 1079-1083 (2004)
PUBMED 15361871
REMARK Erratum:[Nat Genet. 2004 Nov;36(11):1238]
REFERENCE 9 (bases 1 to 95)
AUTHORS Kim,J., Krichevsky,A., Grad,Y., Hayes,G.D., Kosik,K.S., Church,G.M.
and Ruvkun,G.
TITLE Identification of many microRNAs that copurify with polyribosomes
in mammalian neurons
JOURNAL Proc Natl Acad Sci U S A 101 (1), 360-365 (2004)
PUBMED 14691248
REFERENCE 10 (bases 1 to 95)
AUTHORS Miska,E.A., Alvarez-Saavedra,E., Townsend,M., Yoshii,A., Sestan,N.,
Rakic,P., Constantine-Paton,M. and Horvitz,H.R.
TITLE Microarray analysis of microRNA expression in the developing
mammalian brain
JOURNAL Genome Biol 5 (9), R68 (2004)
PUBMED 15345052
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from JAXUCZ010000007.1.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: SRR26360186.116714.1,
SRR22582419.238073.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-95 JAXUCZ010000007.1 118683623-118683717
FEATURES Location/Qualifiers
source 1..95
/organism="Rattus norvegicus"
/mol_type="transcribed RNA"
/strain="BN"
/db_xref="taxon:10116"
/chromosome="7"
/map="7q34"
gene 1..95
/gene="Mirlet7c-2"
/gene_synonym="Mirlet7c2; rno-let-7c-2"
/note="microRNA let-7a-3"
/db_xref="GeneID:100314224"
/db_xref="miRBase:MI0000831"
/db_xref="RGD:2325399"
precursor_RNA 1..95
/gene="Mirlet7c-2"
/gene_synonym="Mirlet7c2; rno-let-7c-2"
/product="microRNA let-7a-3"
/db_xref="GeneID:100314224"
/db_xref="miRBase:MI0000831"
/db_xref="RGD:2325399"
exon 1..95
/gene="Mirlet7c-2"
/gene_synonym="Mirlet7c2; rno-let-7c-2"
/inference="alignment:Splign:2.1.0"
ncRNA 14..35
/ncRNA_class="miRNA"
/gene="Mirlet7c-2"
/gene_synonym="Mirlet7c2; rno-let-7c-2"
/product="rno-let-7c-5p"
/db_xref="miRBase:MIMAT0000776"
/db_xref="GeneID:100314224"
/db_xref="miRBase:MI0000831"
/db_xref="RGD:2325399"
ncRNA 62..83
/ncRNA_class="miRNA"
/gene="Mirlet7c-2"
/gene_synonym="Mirlet7c2; rno-let-7c-2"
/product="rno-let-7c-2-3p"
/db_xref="miRBase:MIMAT0017088"
/db_xref="GeneID:100314224"
/db_xref="miRBase:MI0000831"
/db_xref="RGD:2325399"
ORIGIN
acggcctttggggtgaggtagtaggttgtatggttttgggctctgccccgctctgcggtaactatacaatctactgtctttcctgaagtggccgc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]