LOCUS       NR_031778                 96 bp    RNA     linear   ROD 02-APR-2024
DEFINITION  Rattus norvegicus microRNA 331 (Mir331), microRNA.
ACCESSION   NR_031778
VERSION     NR_031778.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 96)
  AUTHORS   Gitai,D.L.G., Dos Santos,Y.D.R., Upadhya,R., Kodali,M., Madhu,L.N.
            and Shetty,A.K.
  TITLE     Extracellular Vesicles in the Forebrain Display Reduced miR-346 and
            miR-331-3p in a Rat Model of Chronic Temporal Lobe Epilepsy
  JOURNAL   Mol Neurobiol 57 (3), 1674-1687 (2020)
   PUBMED   31813125
  REMARK    GeneRIF: Extracellular Vesicles in the Forebrain Display Reduced
            miR-346 and miR-331-3p in a Rat Model of Chronic Temporal Lobe
            Epilepsy.
REFERENCE   2  (bases 1 to 96)
  AUTHORS   Lee,H., Jee,Y., Hong,K., Hwang,G.S. and Chun,K.H.
  TITLE     MicroRNA-494, upregulated by tumor necrosis factor-alpha,
            desensitizes insulin effect in C2C12 muscle cells
  JOURNAL   PLoS One 8 (12), e83471 (2013)
   PUBMED   24349514
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 96)
  AUTHORS   Wu,S.C., Yang,J.C., Rau,C.S., Chen,Y.C., Lu,T.H., Lin,M.W.,
            Tzeng,S.L., Wu,Y.C., Wu,C.J. and Hsieh,C.H.
  TITLE     Profiling circulating microRNA expression in experimental sepsis
            using cecal ligation and puncture
  JOURNAL   PLoS One 8 (10), e77936 (2013)
   PUBMED   24205035
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 96)
  AUTHORS   Zhang,Q., Liu,H., McGee,J., Walsh,E.J., Soukup,G.A. and He,D.Z.
  TITLE     Identifying microRNAs involved in degeneration of the organ of
            corti during age-related hearing loss
  JOURNAL   PLoS One 8 (4), e62786 (2013)
   PUBMED   23646144
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 96)
  AUTHORS   Polikepahad,S. and Corry,D.B.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   6  (bases 1 to 96)
  AUTHORS   Medrano,S., Monteagudo,M.C., Sequeira-Lopez,M.L., Pentz,E.S. and
            Gomez,R.A.
  TITLE     Two microRNAs, miR-330 and miR-125b-5p, mark the juxtaglomerular
            cell and balance its smooth muscle phenotype
  JOURNAL   Am J Physiol Renal Physiol 302 (1), F29-F37 (2012)
   PUBMED   21993888
REFERENCE   7  (bases 1 to 96)
  AUTHORS   Tarantino,C., Paolella,G., Cozzuto,L., Minopoli,G., Pastore,L.,
            Parisi,S. and Russo,T.
  TITLE     miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic
            stem cells
  JOURNAL   FASEB J 24 (9), 3255-3263 (2010)
   PUBMED   20439489
REFERENCE   8  (bases 1 to 96)
  AUTHORS   Linsen,S.E., de Wit,E., de Bruijn,E. and Cuppen,E.
  TITLE     Small RNA expression and strain specificity in the rat
  JOURNAL   BMC Genomics 11, 249 (2010)
   PUBMED   20403161
  REMARK    Publication Status: Online-Only
REFERENCE   9  (bases 1 to 96)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   10 (bases 1 to 96)
  AUTHORS   Kim,J., Krichevsky,A., Grad,Y., Hayes,G.D., Kosik,K.S., Church,G.M.
            and Ruvkun,G.
  TITLE     Identification of many microRNAs that copurify with polyribosomes
            in mammalian neurons
  JOURNAL   Proc Natl Acad Sci U S A 101 (1), 360-365 (2004)
   PUBMED   14691248
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JAXUCZ010000007.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: SRR26360176.2256822.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-96                JAXUCZ010000007.1  30414386-30414481   c
FEATURES             Location/Qualifiers
     source          1..96
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="7"
                     /map="7q13"
     gene            1..96
                     /gene="Mir331"
                     /gene_synonym="rno-mir-331"
                     /note="microRNA 331"
                     /db_xref="GeneID:100313975"
                     /db_xref="miRBase:MI0000608"
                     /db_xref="RGD:2325619"
     precursor_RNA   1..96
                     /gene="Mir331"
                     /gene_synonym="rno-mir-331"
                     /product="microRNA 331"
                     /db_xref="GeneID:100313975"
                     /db_xref="miRBase:MI0000608"
                     /db_xref="RGD:2325619"
     exon            1..96
                     /gene="Mir331"
                     /gene_synonym="rno-mir-331"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           7..25
                     /ncRNA_class="miRNA"
                     /gene="Mir331"
                     /gene_synonym="rno-mir-331"
                     /product="rno-miR-331-5p"
                     /db_xref="miRBase:MIMAT0017033"
                     /db_xref="GeneID:100313975"
                     /db_xref="miRBase:MI0000608"
                     /db_xref="RGD:2325619"
     ncRNA           61..81
                     /ncRNA_class="miRNA"
                     /gene="Mir331"
                     /gene_synonym="rno-mir-331"
                     /product="rno-miR-331-3p"
                     /db_xref="miRBase:MIMAT0000570"
                     /db_xref="GeneID:100313975"
                     /db_xref="miRBase:MI0000608"
                     /db_xref="RGD:2325619"
ORIGIN      

gagtctggtcttgtttgggtttgttctaggtatggtcccagggatcccagatcaaaccaggcccctgggcctatcctagaaccaacctaaacccat

//