LOCUS       NR_031775                 84 bp    RNA     linear   ROD 24-SEP-2023
DEFINITION  Rattus norvegicus microRNA 328 (Mir328), microRNA.
ACCESSION   NR_031775
VERSION     NR_031775.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 84)
  AUTHORS   Yuan J, Li S, Han Y, Li F, Shi H, Shi W and Cui W.
  TITLE     Restoration of miR-328a-5p function curtails hypoxic pulmonary
            hypertension through a mechanism involving
            PIN1/GSK3beta/beta-catenin axis
  JOURNAL   Int Immunopharmacol 123, 110599 (2023)
   PUBMED   37567011
  REMARK    GeneRIF: Restoration of miR-328a-5p function curtails hypoxic
            pulmonary hypertension through a mechanism involving
            PIN1/GSK3beta/beta-catenin axis.
REFERENCE   2  (bases 1 to 84)
  AUTHORS   Qiao P, Wu W, Wu Y and Wang X.
  TITLE     miR-328a-3p modulates the proliferative and migratory abilities of
            Schwann cells in peripheral nerves
  JOURNAL   Neurosci Lett 791, 136893 (2022)
   PUBMED   36191794
  REMARK    GeneRIF: miR-328a-3p modulates the proliferative and migratory
            abilities of Schwann cells in peripheral nerves.
REFERENCE   3  (bases 1 to 84)
  AUTHORS   Zheng Y, Wang HQ, Guo HX, Xie HL, Zhang WD, Han DX, Jiang H, Yuan B
            and Zhang JB.
  TITLE     CircRNA-WNK2 Acts as a ceRNA for miR-328a-3p to Promote AANAT
            Expression in the Male Rat Pineal Gland
  JOURNAL   Endocrinology 163 (2) (2022)
   PUBMED   34918065
  REMARK    GeneRIF: CircRNA-WNK2 Acts as a ceRNA for miR-328a-3p to Promote
            AANAT Expression in the Male Rat Pineal Gland.
REFERENCE   4  (bases 1 to 84)
  AUTHORS   Zhang H, Huang J, Liu J, Li Y and Gao Y.
  TITLE     BMMSC-sEV-derived miR-328a-3p promotes ECM remodeling of damaged
            urethral sphincters via the Sirt7/TGFbeta signaling pathway
  JOURNAL   Stem Cell Res Ther 11 (1), 286 (2020)
   PUBMED   32678010
  REMARK    GeneRIF: BMMSC-sEV-derived miR-328a-3p promotes ECM remodeling of
            damaged urethral sphincters via the Sirt7/TGFbeta signaling
            pathway.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 84)
  AUTHORS   Ye HK, Zhang HH and Tan ZM.
  TITLE     MiR-328 inhibits cell apoptosis and improves cardiac function in
            rats with myocardial ischemia-reperfusion injury through MEK-ERK
            signaling pathway
  JOURNAL   Eur Rev Med Pharmacol Sci 24 (6), 3315-3321 (2020)
   PUBMED   32271449
  REMARK    GeneRIF: MiR-328 inhibits cell apoptosis and improves cardiac
            function in rats with myocardial ischemia-reperfusion injury
            through MEK-ERK signaling pathway.
REFERENCE   6  (bases 1 to 84)
  AUTHORS   Polikepahad S and Corry DB.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   7  (bases 1 to 84)
  AUTHORS   Linsen SE, de Wit E, de Bruijn E and Cuppen E.
  TITLE     Small RNA expression and strain specificity in the rat
  JOURNAL   BMC Genomics 11, 249 (2010)
   PUBMED   20403161
  REMARK    Publication Status: Online-Only
REFERENCE   8  (bases 1 to 84)
  AUTHORS   Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A,
            Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND,
            Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U,
            Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien
            M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung
            V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G,
            Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P,
            Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C,
            Zavolan M and Tuschl T.
  TITLE     A mammalian microRNA expression atlas based on small RNA library
            sequencing
  JOURNAL   Cell 129 (7), 1401-1414 (2007)
   PUBMED   17604727
REFERENCE   9  (bases 1 to 84)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   10 (bases 1 to 84)
  AUTHORS   Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM and
            Ruvkun G.
  TITLE     Identification of many microRNAs that copurify with polyribosomes
            in mammalian neurons
  JOURNAL   Proc Natl Acad Sci U S A 101 (1), 360-365 (2004)
   PUBMED   14691248
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JACYVU010000313.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-84                JACYVU010000313.1  10230136-10230219   c
FEATURES             Location/Qualifiers
     source          1..84
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="19"
                     /map="19q11"
     gene            1..84
                     /gene="Mir328"
                     /gene_synonym="Mir328a; rno-mir-328; rno-mir-328a"
                     /note="microRNA 328"
                     /db_xref="GeneID:100314218"
                     /db_xref="miRBase:MI0000602"
                     /db_xref="RGD:2325404"
     precursor_RNA   1..84
                     /gene="Mir328"
                     /gene_synonym="Mir328a; rno-mir-328; rno-mir-328a"
                     /product="microRNA 328"
                     /db_xref="GeneID:100314218"
                     /db_xref="miRBase:MI0000602"
                     /db_xref="RGD:2325404"
     exon            1..84
                     /gene="Mir328"
                     /gene_synonym="Mir328a; rno-mir-328; rno-mir-328a"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           8..26
                     /ncRNA_class="miRNA"
                     /gene="Mir328"
                     /gene_synonym="Mir328a; rno-mir-328; rno-mir-328a"
                     /product="rno-miR-328a-5p"
                     /db_xref="miRBase:MIMAT0017029"
                     /db_xref="GeneID:100314218"
                     /db_xref="miRBase:MI0000602"
                     /db_xref="RGD:2325404"
     ncRNA           48..69
                     /ncRNA_class="miRNA"
                     /gene="Mir328"
                     /gene_synonym="Mir328a; rno-mir-328; rno-mir-328a"
                     /product="rno-miR-328a-3p"
                     /db_xref="miRBase:MIMAT0000564"
                     /db_xref="GeneID:100314218"
                     /db_xref="miRBase:MI0000602"
                     /db_xref="RGD:2325404"
ORIGIN      

tggggcaggggggcaggaggggctcagggagaaagcatctacagcccctggccctctctgcccttccgtcccctgtccccaaat

//