ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-20 12:56:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_176857 3864 bp mRNA linear ROD 20-MAR-2023
DEFINITION Rattus norvegicus valosin containing protein interacting protein 1
(Vcpip1), mRNA.
ACCESSION NM_176857
VERSION NM_176857.3
KEYWORDS RefSeq; RefSeq Select.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 3864)
AUTHORS Mevissen TE, Hospenthal MK, Geurink PP, Elliott PR, Akutsu M,
Arnaudo N, Ekkebus R, Kulathu Y, Wauer T, El Oualid F, Freund SM,
Ovaa H and Komander D.
TITLE OTU deubiquitinases reveal mechanisms of linkage specificity and
enable ubiquitin chain restriction analysis
JOURNAL Cell 154 (1), 169-184 (2013)
PUBMED 23827681
REFERENCE 2 (bases 1 to 3864)
AUTHORS Totsukawa G, Kaneko Y, Uchiyama K, Toh H, Tamura K and Kondo H.
TITLE VCIP135 deubiquitinase and its binding protein, WAC, in
p97ATPase-mediated membrane fusion
JOURNAL EMBO J 30 (17), 3581-3593 (2011)
PUBMED 21811234
REMARK GeneRIF: WAC is hence thought to function in p97/p47-mediated Golgi
membrane fusion by activating the deubiquitinating function of
VCIP135.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 3864)
AUTHORS Arakawa T, Katada A, Shigyo H, Kishibe K, Adachi M, Nonaka S and
Harabuchi Y.
TITLE Electrical stimulation prevents apoptosis in denervated skeletal
muscle
JOURNAL NeuroRehabilitation 27 (2), 147-154 (2010)
PUBMED 20871144
REMARK GeneRIF: Electrical stimulation increased valosin-containing
protein (VCP) expression and decreased cleaved caspase-12
expression in denervated muscles.
REFERENCE 4 (bases 1 to 3864)
AUTHORS Faouzi S, Medzihradszky KF, Hefner C, Maher JJ and Correia MA.
TITLE Characterization of the physiological turnover of native and
inactivated cytochromes P450 3A in cultured rat hepatocytes: a role
for the cytosolic AAA ATPase p97?
JOURNAL Biochemistry 46 (26), 7793-7803 (2007)
PUBMED 17550236
REMARK GeneRIF: findings clearly reveal that native CYPs 3A undergo UPD
and implicate a role for p97 in this process.
REFERENCE 5 (bases 1 to 3864)
AUTHORS Trinidad JC, Specht CG, Thalhammer A, Schoepfer R and Burlingame
AL.
TITLE Comprehensive identification of phosphorylation sites in
postsynaptic density preparations
JOURNAL Mol Cell Proteomics 5 (5), 914-922 (2006)
PUBMED 16452087
REFERENCE 6 (bases 1 to 3864)
AUTHORS Yamamoto S, Tomita Y, Hoshida Y, Iizuka N, Kidogami S, Miyata H,
Takiguchi S, Fujiwara Y, Yasuda T, Yano M, Nakamori S, Sakon M,
Monden M and Aozasa K.
TITLE Expression level of valosin-containing protein (p97) is associated
with prognosis of esophageal carcinoma
JOURNAL Clin Cancer Res 10 (16), 5558-5565 (2004)
PUBMED 15328197
REMARK GeneRIF: Expression is ignificant in the prognosis of esophageal
squamous cell carcinoma
REFERENCE 7 (bases 1 to 3864)
AUTHORS Wang Y, Satoh A, Warren G and Meyer HH.
TITLE VCIP135 acts as a deubiquitinating enzyme during p97-p47-mediated
reassembly of mitotic Golgi fragments
JOURNAL J Cell Biol 164 (7), 973-978 (2004)
PUBMED 15037600
REMARK GeneRIF: p97-p47-mediated reassembly of Golgi cisternae requires
ubiquitin, but is not dependent on proteasome-mediated proteolysis.
Erratum:[J Cell Biol. 2004 Aug 2;166(3):433. Wang, Yangzhuang
[corrected to Wang, Yanzhuang]]
REFERENCE 8 (bases 1 to 3864)
AUTHORS Uchiyama K, Jokitalo E, Lindman M, Jackman M, Kano F, Murata M,
Zhang X and Kondo H.
TITLE The localization and phosphorylation of p47 are important for Golgi
disassembly-assembly during the cell cycle
JOURNAL J Cell Biol 161 (6), 1067-1079 (2003)
PUBMED 12810701
REMARK GeneRIF: P47 localizes to the nucleus during interphase and is
phosphorylated on Serine-140 by Cdc2 at mitosis. Phosphorylated p47
does not bind to Golgi membranes.
REFERENCE 9 (bases 1 to 3864)
AUTHORS Uchiyama K, Jokitalo E, Kano F, Murata M, Zhang X, Canas B, Newman
R, Rabouille C, Pappin D, Freemont P and Kondo H.
TITLE VCIP135, a novel essential factor for p97/p47-mediated membrane
fusion, is required for Golgi and ER assembly in vivo
JOURNAL J Cell Biol 159 (5), 855-866 (2002)
PUBMED 12473691
REMARK GeneRIF: VCIP135 is required for golgi and endoplasmic reticulum
assembly.
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from AB045378.2.
On Jun 10, 2007 this sequence version replaced NM_176857.2.
##Evidence-Data-START##
Transcript exon combination :: AB045378.2, AF289091.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMD00132261, SAMD00132263
[ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on single protein-coding transcript
##RefSeq-Attributes-END##
FEATURES Location/Qualifiers
source 1..3864
/organism="Rattus norvegicus"
/mol_type="mRNA"
/db_xref="taxon:10116"
/chromosome="5"
/map="5q11"
gene 1..3864
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="valosin containing protein interacting protein 1"
/db_xref="GeneID:286761"
/db_xref="RGD:708520"
exon 1..2824
/gene="Vcpip1"
/gene_synonym="Vcip135"
/inference="alignment:Splign:2.1.0"
misc_feature 40..42
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="upstream in-frame stop codon"
CDS 118..3783
/gene="Vcpip1"
/gene_synonym="Vcip135"
/EC_number="3.4.19.12"
/note="deubiquitinating protein VCIP135;
valosin-containing protein p97/p47 complex-interacting
protein 1; valosin-containing protein p97/p47
complex-interacting protein p135; VCP(p97)/p47-interacting
protein; valosin-containing protein (p97)/p47
complex-interacting protein 135; VCP/p47
complex-interacting 135-kDa protein"
/codon_start=1
/product="deubiquitinating protein VCPIP1"
/protein_id="NP_789827.3"
/db_xref="GeneID:286761"
/db_xref="RGD:708520"
/translation="
MSQPPPPPPLPPPPPPPEAPQTSSSLAAAATPGGLSKRRDRRILSGSCPDPKCQARLFFPASGSVSIECTECGQRHEQQQLLGVEEVTDPDVVLHNLLRNALLGVTGAPKKNTELVKVMGLSNYHCKLLSPILARYGMDKQTGRAKLLRDMNQGELFDCALLGDRAFLIEPEHVNTVGYGKDRSGSLLYLHDTLEDIKRANKSQECLIPVHVDGDGHCLVHAVSRALVGRELFWHALRENLKQHFQQHLARYQALFHDFIDAAEWEDIINECDPLFVPPEGVPLGLRNIHIFGLANVLHRPIILLDSLSGMRSSGDYSATFLPGLIPAEKCTGRDGHLNKPICIAWSSSGRNHYIPLVGIKGAALPKLPMNLLPKAWGVPQDLIKKYIKLEEDGGCVIGGDRSLQDKYLLRLVAAMEEVFMDKHGIHPSLVADVHQYFYRRTGVIGVQPEEVTAAAKKAVMDNRLHKCLLCGALSELHVPPEWLAPGGKLYNLAKSTHGQLRPDKNYSFPLNNLVCSYDPVKDVLLPDYGLSNLTACNWCHGTSVRRVRGDGSIVYLDGDRTNSRSTGGKCGCGFKHFWEGKEYDNLPEAFPITLEWGGRVVRETVYWFQYESDPSLNSNVYDVAMKLVTKHFPGEFGSEILVQKVVHTILHQTAKKNPDDYTPVNIDGAHAQRIGDVQGQELESQLPTKIILTGQKTKTLHKEELNMSKTERTIQQNITEQASVMQKRKTEKLKQEQKGQPRTVSPSTIRDGPSSAPATPTKAPYSPTTSKEKKIRITTNDGRQSMVTLKSSTTFFELQESIAREFNIPPYLQCIRYGFPPKELMPPQAGMEKEPVPLQHGDRITIEILKGKAEGGPSTAAHSAHTVRQEEIAVTGKLSSKELQEQADKEMYSLCLLATLMGEDVWSYAKGLPHMFQQGGVFYNIMKKTMGMADGKHCTFPHLPGKTFVYNASEDRLELCVDAAGHFPIGPDVEDLVKEAVSQVRAEATTRSRESSPSHGLLKLGSGGVVKKKSEQLHNVTAFQGKGHSLGTASSNPHMDPRARETLAVRKHNTGTDFSNSSIKTEPPVFTAASSNSELIRIAPGVVTMRDGRQIDPDVVEAQRKKLQEMVSSIQASMDKHLRDQSTEQTPSDLSQRKVEAVSSSVRPGNLQTGLPESFSLTGGTENLNTETTDSRVADVLGAAFATRSKAQKENSMEEPEEMDSQDAETTNTTEPMDHS"
misc_feature 118..237
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 223..720
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="VCIP135 N-terminal; Region: VCIP135_N; pfam19437"
/db_xref="CDD:437269"
misc_feature 604..1194
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="OTU (ovarian tumor) domain of deubiquitinating
protein VCIP135; Region: OTU_VCIP135; cd22769"
/db_xref="CDD:438606"
misc_feature order(730..735,907..909,928..930,970..978,1042..1044,
1171..1173,1177..1179)
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="putative polypeptide substrate binding site
[polypeptide binding]; other site"
/db_xref="CDD:438606"
misc_feature order(760..762,769..771,1174..1176)
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="active site"
/db_xref="CDD:438606"
misc_feature 1336..1338
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="N6-acetyllysine.
/evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
UniProtKB/Swiss-Prot (Q8CF97.2); acetylation site"
misc_feature 2287..2451
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 2353..2355
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="Phosphoserine.
/evidence=ECO:0007744|PubMed:22673903; propagated from
UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
misc_feature 2383..2385
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
misc_feature 2401..2403
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="Phosphothreonine.
/evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
misc_feature 2416..2418
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
misc_feature 2437..2661
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="ubiquitin-like (Ubl) domain found in ubiquitin
thioesterase OTU1 and similar proteins; Region: Ubl_OTU1;
cd17059"
/db_xref="CDD:340579"
misc_feature order(2446..2448,2473..2475,2566..2568,2575..2577,
2581..2583,2587..2589,2635..2649,2659..2661)
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="VCP interaction site [polypeptide binding]; other
site"
/db_xref="CDD:340579"
misc_feature 3079..3144
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 3094..3096
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
misc_feature 3106..3108
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
misc_feature 3343..3345
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
misc_feature 3466..3648
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 3682..3780
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="propagated from UniProtKB/Swiss-Prot (Q8CF97.2);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 3706..3708
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="Phosphoserine.
/evidence=ECO:0007744|PubMed:22673903; propagated from
UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
misc_feature 3733..3735
/gene="Vcpip1"
/gene_synonym="Vcip135"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q96JH7; propagated from
UniProtKB/Swiss-Prot (Q8CF97.2); phosphorylation site"
exon 2825..2911
/gene="Vcpip1"
/gene_synonym="Vcip135"
/inference="alignment:Splign:2.1.0"
exon 2912..3864
/gene="Vcpip1"
/gene_synonym="Vcip135"
/inference="alignment:Splign:2.1.0"
ORIGIN
ctggtagggaaaggaaagccattcgctctgggcctggactagacctcgtcgggccggcggaggtctggctatgtgcctttgagggtcgcttgggacgcagagcgagagccgagagcgatgtctcagccgccgccgcctcctccgctgccgccgccgccgcctccccccgaggctccgcagacttcgtcgtccctggcggcggcggctactccggggggcctttcgaaacgaagggaccggagaatcctttccgggagctgcccggatcccaagtgccaggcgcggctcttcttcccggcctcaggttctgtcagcatcgagtgtaccgagtgcggacagcggcacgagcagcaacagctgctgggagtggaggaggtgaccgacccggacgtagtgctgcacaatctgctgcggaacgcgctactcggggtgacgggggctcccaagaagaacacggaactggtaaaggtgatgggcctctccaactaccactgcaaattattgtcgcccatattggcacgctatggaatggacaaacaaacgggccgcgccaagcttctccgggacatgaaccaaggcgaactgttcgattgcgcgttactcggtgaccgggccttcctcatcgaaccagagcacgtcaacacagtgggctatggcaaggaccgatctggaagcctcctatatttgcatgacactctcgaggatatcaaacgggccaataaaagtcaagaatgccttattccagtgcatgtggatggggatggacactgcctagtgcatgctgtgtctagggctctagtaggccgagagctcttctggcatgccctgagggagaatctgaagcagcactttcagcagcacctagcccgatatcaagccctgtttcatgactttattgatgctgcagagtgggaggacattatcaatgaatgtgaccctctgtttgtgccacctgaaggtgtccccttaggcctgaggaatatccacatatttggccttgccaatgtgttacatcgtcccataattctcttagattccctcagtggcatgagaagctctggtgattattcagccacctttctacctgggctcatacctgcagagaagtgcactgggagagatggtcatttgaacaagccaatctgtattgcgtggagtagctctggtagaaaccattatattcccttggtaggcataaagggggctgccttgcccaaactacccatgaatttgctacctaaagcatggggtgtgcctcaggaccttattaaaaagtacatcaagcttgaggaggatggtggttgtgttattggaggagacagaagtttgcaggataagtacttacttaggttggttgctgctatggaggaagtctttatggacaaacatggtatccatcctagtttggttgctgatgtacatcagtatttctacagaaggactggggtgataggagttcagcctgaggaagttacagcagctgctaaaaaagcagtaatggataatcgccttcacaagtgtttgctttgtggtgccctttctgaacttcatgtccctcctgagtggttggctccaggaggaaaactgtataacctggcaaaaagtactcatggacagctgaggcctgacaaaaattacagctttcctttaaacaatttggtttgttcatatgatccagtgaaagatgttctgttaccagactatggattgagtaatctaacagcttgtaattggtgccatggcacatctgtgcgaagagtcagaggcgatggctctattgtatatttggatggagacagaactaattctaggtctactggtggcaaatgtggttgtggattcaaacacttttgggaaggtaaagaatatgacaaccttccagaagcttttcctatcactttggagtggggaggaagagtagtcagagaaacagtatattggttccagtatgaaagtgatccatctttgaatagtaatgtttatgatgttgcaatgaaacttgttaccaagcactttccaggtgaatttgggagtgagatcctagttcagaaagttgtccacactatattgcatcagactgcaaaaaaaaatcctgacgattacactcctgtaaatatagatggtgctcatgctcagagaattggagatgtgcaaggacaagaattggagtctcagctaccaactaaaattattcttactggacagaaaacaaaaactttgcacaaggaagaattaaacatgagtaaaactgaaagaactattcaacagaacatcacagaacaagcttctgtgatgcagaaacggaaaacagagaaattaaaacaagagcaaaaggggcaacccagaactgtttctccaagtactattcgtgatgggccttcatctgcacctgccacccccacgaaggctccctactcacctaccacttctaaggagaagaagattcgcataacaactaatgatggacggcagtccatggttacccttaagtcttcaacaaccttttttgaacttcaggaaagtatagccagagagttcaacattcctccatatttacagtgtattcgatatggttttcctcctaaagagttaatgccaccccaagcaggaatggaaaaggagccagttcctttgcagcatggtgacagaattaccatagagatcttaaaaggcaaagcagaaggtggtccatccactgctgcacactcagcccacactgtgagacaagaagagattgctgttactggcaagctgtcctccaaggaacttcaggagcaagctgacaaagaaatgtattccttgtgtcttttagcaacattaatgggagaagacgtgtggtcttatgcaaagggacttcctcacatgttccagcagggtggtgtattctacaatattatgaagaaaactatgggcatggctgatggcaaacattgtacttttccacatctacctggcaaaacctttgtttataatgcttctgaagacagactggagttgtgtgtcgatgccgcaggacatttccccattggtcctgatgttgaagatttagttaaagaggctgtaagtcaggttcgagcagaggctactacaagaagtagggaatcaagcccttcacatgggttattaaaactaggtagtggtggagtagtgaaaaagaagtctgagcaacttcacaatgtaactgcctttcaggggaagggccattctctaggaactgcatccagtaacccgcacatggatcccagagctagggaaactctggctgtaagaaagcataatacagggacagattttagtaatagttccattaaaacagagcctcctgtgttcacagctgcttctagtaatagtgagcttattcgaatagctcctggagtggtaacaatgagagatggtaggcagattgatcccgatgtggttgaggcccagcgaaaaaaattgcaggaaatggtttcttctattcaggcatcaatggacaagcacttgcgggatcaaagtacagagcaaacaccatctgatctttctcaaagaaaagtagaagctgtgagttcttctgtgaggcctgggaatcttcagactggcttgcctgaatctttttctttaactggtggcactgagaatttgaatactgaaacaactgatagtcgtgtagcagatgtactgggagcagcatttgccacaaggtcaaaagcacaaaaagaaaattccatggaggaacctgaagagatggatagtcaagatgctgagacaactaacacaactgagccgatggatcactcttgatttaatttagaggctaataaaggcagatgtttattgtgaatatgtaatatttgttggctgggccacataacttgagtagtc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]