2024-04-27 08:16:48, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_153821 1377 bp mRNA linear ROD 22-MAR-2023 DEFINITION Rattus norvegicus paired related homeobox 1 (Prrx1), mRNA. ACCESSION NM_153821 VERSION NM_153821.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1377) AUTHORS Yin L, Liu MX, Wang FY, Wang X, Tang YH, Zhao QY, Wang T, Chen YT and Huang CX. TITLE Transcription Factor prrx1 Promotes Brown Adipose-Derived Stem Cells Differentiation to Sinus Node-Like Cells JOURNAL DNA Cell Biol 38 (11), 1313-1322 (2019) PUBMED 31545082 REMARK GeneRIF: Overexpression of prrx1 can successfully induce sinus node-like cells. REFERENCE 2 (bases 1 to 1377) AUTHORS Gong J, Han J, He J, Liu J, Han P, Wang Y, Li M, Li D, Ding X, Du Z, Liao J and Tian D. TITLE Paired related homeobox protein 1 regulates PDGF-induced chemotaxis of hepatic stellate cells in liver fibrosis JOURNAL Lab Invest 97 (9), 1020-1032 (2017) PUBMED 28737764 REMARK GeneRIF: Studied and identified Prrx1 as a novel valuable target in liver fibrosis. Prxx1 was found to have a major role in PDGF-induced migration and chemotaxis. REFERENCE 3 (bases 1 to 1377) AUTHORS Takahashi T, Zimmer J, Friedmacher F and Puri P. TITLE Expression of Prx1 and Tcf4 is decreased in the diaphragmatic muscle connective tissue of nitrofen-induced congenital diaphragmatic hernia JOURNAL J Pediatr Surg 51 (12), 1931-1935 (2016) PUBMED 27665494 REMARK GeneRIF: expression of Prx1 and Tcf4 is decreased in the developing diaphragm in the nitrofen-induced congenital diaphragmatic hernia in Sprague- Dawley rats animal model. REFERENCE 4 (bases 1 to 1377) AUTHORS Liu N, Xue L, Guan Y, Li QZ, Cao FY, Pang SL and Guan WJ. TITLE Expression of Peroxiredoxins and Pulmonary Surfactant Protein A Induced by Silica in Rat Lung Tissue JOURNAL Biomed Environ Sci 29 (8), 584-588 (2016) PUBMED 27660222 REMARK GeneRIF: Prdx1 and Prdx6 proteins is involved in pulmonary fibrosis induced by silica. REFERENCE 5 (bases 1 to 1377) AUTHORS Higuchi M, Kato T, Yoshida S, Ueharu H, Nishimura N and Kato Y. TITLE PRRX1- and PRRX2-positive mesenchymal stem/progenitor cells are involved in vasculogenesis during rat embryonic pituitary development JOURNAL Cell Tissue Res 361 (2), 557-565 (2015) PUBMED 25795141 REMARK GeneRIF: PRRX1- and PRRX2-positive mesenchymal stem/progenitor cells are present at the periphery of the embryonic pituitary and participate in pituitary vasculogenesis by differentiation into vascular endothelial cells and pericytes. REFERENCE 6 (bases 1 to 1377) AUTHORS Lu MF, Cheng HT, Kern MJ, Potter SS, Tran B, Diekwisch TG and Martin JF. TITLE prx-1 functions cooperatively with another paired-related homeobox gene, prx-2, to maintain cell fates within the craniofacial mesenchyme JOURNAL Development 126 (3), 495-504 (1999) PUBMED 9876178 REFERENCE 7 (bases 1 to 1377) AUTHORS Lu MF, Cheng HT, Lacy AR, Kern MJ, Argao EA, Potter SS, Olson EN and Martin JF. TITLE Paired-related homeobox genes cooperate in handplate and hindlimb zeugopod morphogenesis JOURNAL Dev Biol 205 (1), 145-157 (1999) PUBMED 9882503 REFERENCE 8 (bases 1 to 1377) AUTHORS ten Berge D, Brouwer A, Korving J, Martin JF and Meijlink F. TITLE Prx1 and Prx2 in skeletogenesis: roles in the craniofacial region, inner ear and limbs JOURNAL Development 125 (19), 3831-3842 (1998) PUBMED 9729491 REFERENCE 9 (bases 1 to 1377) AUTHORS Hu Y, Flanagan J, Brennan DP, Zhou H, Ng KW, Eisman JA and Morrison NA. TITLE rHox: a homeobox gene expressed in osteoblastic cells JOURNAL J Cell Biochem 59 (4), 486-497 (1995) PUBMED 8749718 REFERENCE 10 (bases 1 to 1377) AUTHORS Martin JF, Bradley A and Olson EN. TITLE The paired-like homeo box gene MHox is required for early events of skeletogenesis in multiple lineages JOURNAL Genes Dev 9 (10), 1237-1249 (1995) PUBMED 7758948 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JACYVU010000244.1. On Nov 27, 2020 this sequence version replaced NM_153821.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR8487230.59492.1, SRR8487231.46550.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA5756307, SAMEA5760383 [ECO:0000350] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, longest protein ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-570 JACYVU010000244.1 6390956-6391525 c 571-746 JACYVU010000244.1 6339438-6339613 c 747-928 JACYVU010000244.1 6333921-6334102 c 929-1377 JACYVU010000244.1 6324227-6324675 c FEATURES Location/Qualifiers source 1..1377 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="13" /map="13q22" gene 1..1377 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /note="paired related homeobox 1" /db_xref="GeneID:266813" /db_xref="RGD:628884" exon 1..570 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /inference="alignment:Splign:2.1.0" misc_feature 144..146 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /note="upstream in-frame stop codon" CDS 330..1067 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /note="rHox; paired-related homeobox protein 1; paired mesoderm homeobox 1" /codon_start=1 /product="paired mesoderm homeobox protein 1" /protein_id="NP_722543.1" /db_xref="GeneID:266813" /db_xref="RGD:628884" /translation="
MTSSYGHVLERQPALGGRLDSPGNLDTLQAKKNFSVSHLLDLEEAGDMVAAQADESVGEAGRSLLESPGLTSGSDTPQQDNDQLNSEEKKKRKQRRNRTTFNSSQLQALERVFERTHYPDAFVREDLARRVNLTEARVQVWFQNRRAKFRRNERAMLANKNASLLKSYSGDVTAVEQPIVPRPAPRPTDYLSWGTASPYSAMATYSATCANNSPAQGINMANSIANLRLKAKEYSLQRNQVPTVN"
misc_feature 330..401 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /note="propagated from UniProtKB/Swiss-Prot (P63014.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 390..392 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:22673903; propagated from UniProtKB/Swiss-Prot (P63014.1); phosphorylation site" misc_feature 489..638 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /note="propagated from UniProtKB/Swiss-Prot (P63014.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 624..779 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(627..629,747..749,756..761,768..770) /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 807..809 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /note="N6-acetyllysine. /evidence=ECO:0000250|UniProtKB:P63013; propagated from UniProtKB/Swiss-Prot (P63014.1); acetylation site" misc_feature 918..920 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /note="Phosphoserine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (P63014.1); phosphorylation site" misc_feature 984..1034 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /note="OAR domain; Region: OAR; pfam03826" /db_xref="CDD:427530" misc_feature 993..1034 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /note="propagated from UniProtKB/Swiss-Prot (P63014.1); Region: OAR. /evidence=ECO:0000255|PROSITE-ProRule:PRU00138" exon 571..746 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /inference="alignment:Splign:2.1.0" exon 747..928 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /inference="alignment:Splign:2.1.0" exon 929..1377 /gene="Prrx1" /gene_synonym="Pmx1; Prx-1" /inference="alignment:Splign:2.1.0" ORIGIN
tttttttttctttctgatttaagcttagcgtgtttgtttgtttggtttggtttttaaactttttttggtgtggattatctctctggaccacgccggacttggcttcagcgaagcaaccgaagctgggagaaagttacttgtgctgaaagttctgcacttcagaagggggtttctctctctctctctctctctctctctctctctctctctctctctcctccactcccccctctttcttccccactcggctcctctcccccctcacgcccacagcgtttggtgttgattcgagcgggaagaggggggtgggtgggattggagggaagaccatgacctccagctacgggcacgttctggagcggcaaccggctctgggcggccgcttggatagccctggcaacctcgacaccctgcaggcgaaaaagaacttctccgtcagtcacctgctagacctggaggaggccggggacatggtggcggcacaggcggacgaaagcgtgggcgaggcgggccggagcctgctggagtcaccgggactgaccagtggcagcgacacccctcagcaggacaatgatcagctgaactctgaggagaagaagaagagaaagcaacggagaaacaggacaaccttcaatagcagccagctgcaggccttggagcgtgtcttcgagaggacccattacccggatgcttttgtacgggaagatcttgcacgtcgggtgaacctcacggaggccagagtgcaggtgtggtttcagaaccgaagagccaagttccgcaggaatgagcgagccatgctggccaataaaaacgcttctctcctcaagtcctactcaggagacgtgactgccgtggaacaacccattgtacctcgtcctgctcccagacccaccgattatctctcctgggggacagcctctccgtacagcgccatggctacttattctgccacatgtgccaacaatagccctgcgcagggtatcaacatggccaacagcattgccaacctgagactgaaggccaaggaatatagtttacagaggaaccaggtgccaacagtcaactgaggaaaaaaataattaaacaggcctaagaagaaatcaaaaaccataagacacctatcctgttctgtcatttcttcatccgccggaaaaaaaaagataaaagcaaacaaacaaagccagaactaaaatattgggaccatggcggagaaaagcaggagaggaacaaaatgaaaattagttaacaaatgtttcttcttcctcttggataccatcaccatttgttgtgtgtgtattttttttccttctacccatgctttgctaagtatacttcaggcttcttctattaggctcaacccacccattcctataattg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]