LOCUS       NM_131905               1514 bp    mRNA    linear   ROD 21-MAR-2023
DEFINITION  Rattus norvegicus claudin 16 (Cldn16), mRNA.
ACCESSION   NM_131905
VERSION     NM_131905.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1514)
  AUTHORS   Shimizu T, Takayanagi K, Iwashita T, Ikari A, Anzai N, Okazaki S,
            Hara H, Hatano M, Sano T, Ogawa T, Kanozawa K and Hasegawa H.
  TITLE     Down-regulation of magnesium transporting molecule, claudin-16, as
            a possible cause of hypermagnesiuria with the development of
            tubulo-interstitial nephropathy
  JOURNAL   Magnes Res 31 (1), 11-23 (2018)
   PUBMED   29991461
  REMARK    GeneRIF: the characteristic hypermagnesiuria in Tubulo-interstitial
            nephropathy is principally caused by the dysfunction of magnesium
            reabsorption in the thick ascending limb of Henle resulting from a
            significant decrease in the claudin-16 expression.
REFERENCE   2  (bases 1 to 1514)
  AUTHORS   Ikari A, Tonegawa C, Sanada A, Kimura T, Sakai H, Hayashi H,
            Hasegawa H, Yamaguchi M, Yamazaki Y, Endo S, Matsunaga T and
            Sugatani J.
  TITLE     Tight junctional localization of claudin-16 is regulated by
            syntaxin 8 in renal tubular epithelial cells
  JOURNAL   J Biol Chem 289 (19), 13112-13123 (2014)
   PUBMED   24659781
  REMARK    GeneRIF: These results suggest that STX8 mediates the recycling of
            CLDN16 and constitutes an important component of the CLDN16
            trafficking machinery in the kidney.
REFERENCE   3  (bases 1 to 1514)
  AUTHORS   Ikari A, Kinjo K, Atomi K, Sasaki Y, Yamazaki Y and Sugatani J.
  TITLE     Extracellular Mg(2+) regulates the tight junctional localization of
            claudin-16 mediated by ERK-dependent phosphorylation
  JOURNAL   Biochim Biophys Acta 1798 (3), 415-421 (2010)
   PUBMED   19914201
  REMARK    GeneRIF: The tight junctional localization of claudin-16 requires a
            physiological Mg(2+) concentration and the phosphorylation of
            threonine residues via a MEK/ERK-dependent pathway.
REFERENCE   4  (bases 1 to 1514)
  AUTHORS   Krause G, Winkler L, Mueller SL, Haseloff RF, Piontek J and Blasig
            IE.
  TITLE     Structure and function of claudins
  JOURNAL   Biochim Biophys Acta 1778 (3), 631-645 (2008)
   PUBMED   18036336
  REMARK    Review article
REFERENCE   5  (bases 1 to 1514)
  AUTHORS   Ikari A, Matsumoto S, Harada H, Takagi K, Degawa M, Takahashi T,
            Sugatani J and Miwa M.
  TITLE     Dysfunction of paracellin-1 by dephosphorylation in Dahl
            salt-sensitive hypertensive rats
  JOURNAL   J Physiol Sci 56 (5), 379-383 (2006)
   PUBMED   16959063
  REMARK    GeneRIF: The role of paracellin-1 phosphorylation state on
            salt-sensitive hypertension in Dahl rats is reported.
REFERENCE   6  (bases 1 to 1514)
  AUTHORS   Ohta H, Adachi H and Inaba M.
  TITLE     Developmental changes in the expression of tight junction protein
            claudins in murine metanephroi and embryonic kidneys
  JOURNAL   J Vet Med Sci 68 (2), 149-155 (2006)
   PUBMED   16520537
REFERENCE   7  (bases 1 to 1514)
  AUTHORS   Ikari A, Hirai N, Shiroma M, Harada H, Sakai H, Hayashi H, Suzuki
            Y, Degawa M and Takagi K.
  TITLE     Association of paracellin-1 with ZO-1 augments the reabsorption of
            divalent cations in renal epithelial cells
  JOURNAL   J Biol Chem 279 (52), 54826-54832 (2004)
   PUBMED   15496416
  REMARK    GeneRIF: Paracellin-1 (PCLN-1)-zona occludens-1 protein(ZO-1) tight
            junction complex may play an essential role in the reabsorption of
            divalent cations in renal epithelial cells
REFERENCE   8  (bases 1 to 1514)
  AUTHORS   Weber S, Schlingmann KP, Peters M, Nejsum LN, Nielsen S, Engel H,
            Grzeschik KH, Seyberth HW, Grone HJ, Nusing R and Konrad M.
  TITLE     Primary gene structure and expression studies of rodent
            paracellin-1
  JOURNAL   J Am Soc Nephrol 12 (12), 2664-2672 (2001)
   PUBMED   11729235
REFERENCE   9  (bases 1 to 1514)
  AUTHORS   Simon DB, Lu Y, Choate KA, Velazquez H, Al-Sabban E, Praga M,
            Casari G, Bettinelli A, Colussi G, Rodriguez-Soriano J, McCredie D,
            Milford D, Sanjad S and Lifton RP.
  TITLE     Paracellin-1, a renal tight junction protein required for
            paracellular Mg2+ resorption
  JOURNAL   Science 285 (5424), 103-106 (1999)
   PUBMED   10390358
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000222.1.
            
            On Jun 9, 2015 this sequence version replaced NM_131905.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF333099.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA5760384, SAMEA5760389
                                           [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-438               JACYVU010000222.1  53618925-53619362   c
            439-541             JACYVU010000222.1  53608159-53608261   c
            542-706             JACYVU010000222.1  53604555-53604719   c
            707-898             JACYVU010000222.1  53601790-53601981   c
            899-1514            JACYVU010000222.1  53600072-53600687   c
FEATURES             Location/Qualifiers
     source          1..1514
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="11"
                     /map="11q22"
     gene            1..1514
                     /gene="Cldn16"
                     /gene_synonym="Pcln1"
                     /note="claudin 16"
                     /db_xref="GeneID:155268"
                     /db_xref="RGD:620322"
     exon            1..438
                     /gene="Cldn16"
                     /gene_synonym="Pcln1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    175..177
                     /gene="Cldn16"
                     /gene_synonym="Pcln1"
                     /note="upstream in-frame stop codon"
     CDS             325..1032
                     /gene="Cldn16"
                     /gene_synonym="Pcln1"
                     /note="paracellin-1"
                     /codon_start=1
                     /product="claudin-16"
                     /protein_id="NP_571980.2"
                     /db_xref="GeneID:155268"
                     /db_xref="RGD:620322"
                     /translation="

MKELLQYAACFLAIFSTGFLIVATWTDCWMVNADDSLEVSTKCRGLWWECVTNAFDGIRTCDEYDSIYAEHPLKLVVTRALMITADILAGFGFITLLLGLDCVKFLPDEPHIKVRLCFVAGTVLLIAGTPGIIGSVWYAVDVYVERSSLVLHNIFLGIQYKFGWSCWLGMAGSLGCFLAGALLTCCLYLFKDVGPERNYPYAMRKPYSTAGVSMAKSYKAPRTETAKMYAVDTRV"

     misc_feature    334..396
                     /gene="Cldn16"
                     /gene_synonym="Pcln1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q91Y55.1);
                     transmembrane region"
     misc_feature    355..873
                     /gene="Cldn16"
                     /gene_synonym="Pcln1"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:451326"
     misc_feature    562..624
                     /gene="Cldn16"
                     /gene_synonym="Pcln1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q91Y55.1);
                     transmembrane region"
     misc_feature    670..732
                     /gene="Cldn16"
                     /gene_synonym="Pcln1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q91Y55.1);
                     transmembrane region"
     misc_feature    832..894
                     /gene="Cldn16"
                     /gene_synonym="Pcln1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q91Y55.1);
                     transmembrane region"
     exon            439..541
                     /gene="Cldn16"
                     /gene_synonym="Pcln1"
                     /inference="alignment:Splign:2.1.0"
     exon            542..706
                     /gene="Cldn16"
                     /gene_synonym="Pcln1"
                     /inference="alignment:Splign:2.1.0"
     exon            707..898
                     /gene="Cldn16"
                     /gene_synonym="Pcln1"
                     /inference="alignment:Splign:2.1.0"
     exon            899..1514
                     /gene="Cldn16"
                     /gene_synonym="Pcln1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

ctgcgactgtcgtttcacgttagaccacagccagggctgcttctcccacgcagcagcacgatgtgttcagttcttcccctgccctggcttctgattgggagcttggctgctggataagtgacctccaggaccctcgctctggtacaacatatttgtacaattctttctgaaatttaaggtgcctgcaagaggggtgtgaggaaacaaaaaggacctagcatccccaggtactggcaacagaagccaatagcatcagaagtcaatcgcattccagctcaactggcatctgcccatgagtcccttcccaacaggctgcttgctgccatgaaggagcttcttcagtacgctgcctgcttcttggccattttctcaactgggtttttgatcgtggccacctggacggactgttggatggtgaacgctgatgactctctggaggtgagcactaaatgcagaggtctctggtgggagtgcgtcacaaacgcttttgatggaattcgtacctgcgatgagtatgactccatatatgcagaacaccccttgaagctggtggtgactcgggcactgatgatcacagccgacattctagctggctttggattcatcaccctcctccttggacttgactgcgtgaagttcctaccggatgagccacacattaaagtccgcctctgctttgttgcagggaccgtattactcatcgcaggtaccccgggaatcattggttctgtgtggtatgctgtggatgtttacgtcgagcgctcctctctcgttttacacaatatatttctcgggatccaatataaattcggttggtcctgctggctcggaatggctgggtctttgggttgttttttggctggagctctcctcacctgctgtttgtacctcttcaaagatgttggacctgagaggaactacccttatgccatgaggaagccctattcaactgcaggtgtttccatggccaaatcctacaaggcccctaggacagagacagccaaaatgtacgctgtagacacgagagtgtaaaatctgccaaatattaatctgtgttcctgtgttgtttaattactcaatcaatgtgttcaagttaataaaataaatgatcgactttggggcattcatttacatttccgattcaaactaattaattgctggttcaatcaaaatgtttgattgtgctgtcatgtctcctatggctttctgtactgcacccccccaagtctgcatgcatttcaagttgacattgagagaatgtagaaatgtgtttcaggtatctttattgcttttggagattatggcatagtaatattaaagtgaagtgatgcttcagaaatgcatagcaattttaaggaggttcaagtcctaattttgaaaggatagaggagctcttagctcaccctgactcgaagcacaattttaattctctgagggtatttatcaatgacttgaaggaaggttattgttctaaatttaaacttgtatatcagaatctaacatactcaaatatt

//