2024-04-18 17:32:57, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_053524 2176 bp mRNA linear ROD 04-JAN-2024 DEFINITION Rattus norvegicus NADPH oxidase 4 (Nox4), mRNA. ACCESSION NM_053524 VERSION NM_053524.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2176) AUTHORS Matsunaga S, Kohda A, Kamakura S, Hayase J, Miyano K, Shiose A and Sumimoto H. TITLE Hypoxia stabilizes the H2 O2 -producing oxidase Nox4 in cardiomyocytes via suppressing autophagy-related lysosomal degradation JOURNAL Genes Cells 29 (1), 63-72 (2024) PUBMED 37985134 REMARK GeneRIF: Hypoxia stabilizes the H2 O2 -producing oxidase Nox4 in cardiomyocytes via suppressing autophagy-related lysosomal degradation. REFERENCE 2 (bases 1 to 2176) AUTHORS Zhang Y, Shan M, Ding X, Sun H, Qiu F and Shi L. TITLE Maternal exercise represses Nox4 via SIRT1 to prevent vascular oxidative stress and endothelial dysfunction in SHR offspring JOURNAL Front Endocrinol (Lausanne) 14, 1219194 (2023) PUBMED 37501791 REMARK GeneRIF: Maternal exercise represses Nox4 via SIRT1 to prevent vascular oxidative stress and endothelial dysfunction in SHR offspring. Publication Status: Online-Only REFERENCE 3 (bases 1 to 2176) AUTHORS Njeim R, Braych K, Ghadieh HE, Azar NS, Azar WS, Dia B, Leone A, Cappello F, Kfoury H, Harb F, Jurjus AR, Eid AA and Ziyadeh FN. TITLE VEGF-A: A Novel Mechanistic Link Between CYP2C-Derived EETs and Nox4 in Diabetic Kidney Disease JOURNAL Diabetes 72 (7), 947-957 (2023) PUBMED 36662655 REMARK GeneRIF: VEGF-A: A Novel Mechanistic Link Between CYP2C-Derived EETs and Nox4 in Diabetic Kidney Disease. REFERENCE 4 (bases 1 to 2176) AUTHORS Sun ZH, Liu F, Kong LL, Ji PM, Huang L, Zhou HM, Sun R, Luo J and Li WZ. TITLE Interruption of TRPC6-NFATC1 signaling inhibits NADPH oxidase 4 and VSMCs phenotypic switch in intracranial aneurysm JOURNAL Biomed Pharmacother 161, 114480 (2023) PUBMED 37002575 REMARK GeneRIF: Interruption of TRPC6-NFATC1 signaling inhibits NADPH oxidase 4 and VSMCs phenotypic switch in intracranial aneurysm. REFERENCE 5 (bases 1 to 2176) AUTHORS Swami Vetha BS, Byrum R, Peele K, Diz D and Aileru A. TITLE Functional Significance of Angiotensin Receptor Type 2 in the Neuroplasticity of Autonomic Ganglia in (mRen2)27 Transgenic Hypertensive Rats JOURNAL J Cardiovasc Pharmacol 81 (1), 76-84 (2023) PUBMED 36166507 REMARK GeneRIF: Functional Significance of Angiotensin Receptor Type 2 in the Neuroplasticity of Autonomic Ganglia in (mRen2)27 Transgenic Hypertensive Rats. Publication Status: Online-Only REFERENCE 6 (bases 1 to 2176) AUTHORS Gorin Y, Ricono JM, Kim NH, Bhandari B, Choudhury GG and Abboud HE. TITLE Nox4 mediates angiotensin II-induced activation of Akt/protein kinase B in mesangial cells JOURNAL Am J Physiol Renal Physiol 285 (2), F219-F229 (2003) PUBMED 12842860 REMARK GeneRIF: Nox4-based NAD(P)H oxidase and generation of reactive oxygen species mediate the effect of ANG II on Akt/PKB activation and protein synthesis in glomerular mesangial cells REFERENCE 7 (bases 1 to 2176) AUTHORS Lassegue B, Sorescu D, Szocs K, Yin Q, Akers M, Zhang Y, Grant SL, Lambeth JD and Griendling KK. TITLE Novel gp91(phox) homologues in vascular smooth muscle cells : nox1 mediates angiotensin II-induced superoxide formation and redox-sensitive signaling pathways JOURNAL Circ Res 88 (9), 888-894 (2001) PUBMED 11348997 REFERENCE 8 (bases 1 to 2176) AUTHORS Yang S, Madyastha P, Bingel S, Ries W and Key L. TITLE A new superoxide-generating oxidase in murine osteoclasts JOURNAL J Biol Chem 276 (8), 5452-5458 (2001) PUBMED 11098048 REFERENCE 9 (bases 1 to 2176) AUTHORS Shiose A, Kuroda J, Tsuruya K, Hirai M, Hirakata H, Naito S, Hattori M, Sakaki Y and Sumimoto H. TITLE A novel superoxide-producing NAD(P)H oxidase in kidney JOURNAL J Biol Chem 276 (2), 1417-1423 (2001) PUBMED 11032835 REFERENCE 10 (bases 1 to 2176) AUTHORS Geiszt M, Kopp JB, Varnai P and Leto TL. TITLE Identification of renox, an NAD(P)H oxidase in kidney JOURNAL Proc Natl Acad Sci U S A 97 (14), 8010-8014 (2000) PUBMED 10869423 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AY027527.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AY027527.1, AB044086.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5760400, SAMEA5760476 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..2176 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="Sprague-Dawley" /db_xref="taxon:10116" /chromosome="1" /map="1q32" gene 1..2176 /gene="Nox4" /note="NADPH oxidase 4" /db_xref="GeneID:85431" /db_xref="RGD:620600" exon 1..106 /gene="Nox4" /inference="alignment:Splign:2.1.0" CDS 50..1786 /gene="Nox4" /EC_number="1.6.3.-" /note="kox-1; kidney superoxide-producing NADPH oxidase; kidney oxidase-1" /codon_start=1 /product="NADPH oxidase 4" /protein_id="NP_445976.1" /db_xref="GeneID:85431" /db_xref="RGD:620600" /translation="
MALSWRSWLANEGVKHLCLLVWLSLNVLLFWKTFLLYNQGPEYYYIHQMLGLGLCLSRASASVLNLNCSLILLPMCRTVLAYLRGSQKVPSRRTRRLLDKSKTLHITCGITICIFSGVHVAAHLVNALNFSVNYSEHFLALNAARYQNEDPRKLLFTTVPGLTGVCMVVVLFLMVTASTYAIRVSNYDIFWYTHNLFFVFYMLLLLHVSGGLLKYQTNLDTHPPGCISLNRTPSQNMSIADYVSEHFHGSLPGGFSKLEDHYQKTLVKICLEEPKFQAHFPQTWIWISGPLCLYCAERLYRCIRSNKPVTIISVINHPSDVMELRMIKENFKARPGQYIILHCPSVSALENHPFTLTMCPTETKATFGVHFKVVGDWTERFRDLLLPPSSQDSEILPFIQSRNYPKLYIDGPFGSPFEESLNYEVSLCVAGGIGVTPFASILNTLLDDWKPYKLRRLYFIWVCRDIQSFQWFADLLYVLHNKFWQENRPDFVNIQLYLSQTDGIQKIIGEKYHTLNSRLFIGRPRWKLLFDEIAKCNRGKTVGVFCCGPSSISKTLHNLSNRNNSYGTKFEYNKESFS"
misc_feature 98..160 /gene="Nox4" /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2); transmembrane region" misc_feature 236..298 /gene="Nox4" /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2); transmembrane region" misc_feature 254..664 /gene="Nox4" /note="Ferric reductase like transmembrane component; Region: Ferric_reduct; pfam01794" /db_xref="CDD:426438" misc_feature 362..424 /gene="Nox4" /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2); transmembrane region" misc_feature 446..448 /gene="Nox4" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (Q924V1.2); glycosylation site" misc_feature 512..574 /gene="Nox4" /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2); transmembrane region" misc_feature 614..676 /gene="Nox4" /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2); transmembrane region" misc_feature 791..1774 /gene="Nox4" /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2); Region: Mediates interaction with TLR4. /evidence=ECO:0000250" misc_feature 980..1780 /gene="Nox4" /note="NADPH oxidase (NOX) catalyzes the generation of reactive oxygen species (ROS) such as superoxide and hydrogen peroxide. ROS were originally identified as bactericidal agents in phagocytes, but are now also implicated in cell signaling and metabolism. NOX...; Region: NOX_Duox_like_FAD_NADP; cd06186" /db_xref="CDD:99783" misc_feature order(1061..1063,1103..1114,1157..1165,1172..1183, 1346..1348) /gene="Nox4" /note="FAD binding pocket [chemical binding]; other site" /db_xref="CDD:99783" misc_feature order(1103..1105,1109..1114) /gene="Nox4" /note="FAD binding motif [chemical binding]; other site" /db_xref="CDD:99783" misc_feature 1322..1384 /gene="Nox4" /note="propagated from UniProtKB/Swiss-Prot (Q924V1.2); transmembrane region" misc_feature 1331..1363 /gene="Nox4" /note="NAD pyrophosphate binding region [chemical binding]; other site" /db_xref="CDD:99783" misc_feature order(1331..1333,1343..1354,1358..1360) /gene="Nox4" /note="beta-alpha-beta stucture motif; other site" /db_xref="CDD:99783" misc_feature order(1346..1351,1433..1441,1691..1696) /gene="Nox4" /note="NAD binding pocket [chemical binding]; other site" /db_xref="CDD:99783" misc_feature order(1427..1432,1439..1441) /gene="Nox4" /note="NADP ribose binding motif [chemical binding]; other site" /db_xref="CDD:99783" exon 107..202 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 203..313 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 314..398 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 399..496 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 497..524 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 525..597 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 598..678 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 679..895 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 896..1060 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 1061..1123 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 1124..1184 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 1185..1266 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 1267..1386 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 1387..1495 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 1496..1564 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 1565..1665 /gene="Nox4" /inference="alignment:Splign:2.1.0" exon 1666..2176 /gene="Nox4" /inference="alignment:Splign:2.1.0" ORIGIN
ctttccgtcccaagcaccgagcggagcgcagcacccccgcgccggcggtatggcgctgtcctggaggagctggctggccaacgaaggggttaaacacctctgtctgcttgtttggctgtccctaaatgtcctgcttttctggaaaaccttcctgctgtacaaccaagggccagaatactactacatccaccagatgttgggcctaggattgtgtttgagcagagcttctgcatctgtcctgaacctcaactgcagcctgatccttttacccatgtgccgcacagtcctggcttaccttcgcggatcacagaaggtccctagcaggagaacaagaagattgttggacaaaagcaagactctacatatcacctgtggcataactatttgtattttctcaggtgtgcatgtagctgcccacttggtgaacgccctgaacttctcagtgaactatagtgaacatttccttgcactgaatgcagcaagataccagaatgaggatcccagaaagcttctcttcacaactgttccgggcctgacaggtgtctgcatggtggtggtattgttcctcatggttacagcttctacctatgcaataagagtttctaattatgatatcttctggtatactcacaacctcttctttgtcttctacatgctgctgctgctgcatgtttcgggtggcttgttgaagtatcaaaccaatttagacactcaccctcctggctgtatcagtcttaaccggaccccatctcagaatatgtccatagcagactacgtctcagaacattttcatggatctttgcctggagggttttcaaaattagaagatcattaccagaaaacactggtgaagatttgcctggaagaacccaagttccaagctcatttcccacagacctggatttggatttctggacctttgtgcctatactgtgctgagagactttaccgatgcatccggagcaacaaacctgtcaccattatctcagtaatcaatcatccctcagatgtcatggaactccgtatgatcaaagaaaactttaaagcaagacctggccagtatattattctacattgtcccagtgtatcagcattagaaaaccacccatttactctcacaatgtgtcctactgaaaccaaagcaacatttggtgtccactttaaagtagtaggagactggacagaaagattccgagatttactactgcctccatcaagccaagattctgagattctgcccttcattcaatctagaaactaccccaagttatacattgatggcccatttggaagtccatttgaggagtcactgaactatgaagttagtctgtgtgtggctggaggcattggggtcactccgtttgcatcgatactaaacactctactggatgactggaaaccatacaagctaagaagactgtattttatctgggtctgcagagacatccaatcattccagtggtttgcagacttgctctatgtgctgcataacaagttttggcaagaaaacagacctgactttgtgaacatccagctgtacctcagtcaaacagatgggatacagaagataattggagaaaaataccacacattgaattctagactttttattgggcgtcctcggtggaagcttttatttgatgaaatagcaaaatgtaacagagggaaaacagttggagttttctgctgtggacccagttctatttccaagactcttcataatttgagtaaccggaacaactcatatgggacaaaatttgaatacaataaagaatctttcagctaaaaccttaggagactactgggactctaaagaaggaacaagtgcaatttctaagacttagagactcggctgaatcagacagctatgctatgccaaagaatatcaaagttttgctatttatgattatttaaaatgagaattcaaaaagtgtggcaaaaatgacatggttaatctgcaagccaaaggggccctgaagaatatttgatgtggtgattcacatattgatgggcaaattaaaagaatgctgttagatgcacactgttgatttttatgggaaattcaagaactctctaatgaggagctgaactcactcactctgaagctgatagccacagccctctttaaattgttttcagtcgaacaggttcaaagattgaacaaaattaaaaattc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]