LOCUS       NM_031567               1565 bp    mRNA    linear   ROD 22-MAR-2023
DEFINITION  Rattus norvegicus nuclear factor I/C (Nfic), mRNA.
ACCESSION   NM_031567 XM_001075535 XM_345789
VERSION     NM_031567.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1565)
  AUTHORS   Zhang F, Liang M, Zhao C, Fu Y and Yu S.
  TITLE     NFIC promotes the vitality and osteogenic differentiation of rat
            dental follicle cells
  JOURNAL   J Mol Histol 50 (5), 471-482 (2019)
   PUBMED   31432308
  REMARK    GeneRIF: pregulation of NFIC may promote the proliferation and
            osteogenic/cementogenic differentiation of dental follicle cells.
REFERENCE   2  (bases 1 to 1565)
  AUTHORS   Chen X, Chen G, Feng L, Jiang Z, Guo W, Yu M and Tian W.
  TITLE     Expression of Nfic during root formation in first mandibular molar
            of rat
  JOURNAL   J Mol Histol 45 (6), 619-626 (2014)
   PUBMED   25074584
  REMARK    GeneRIF: Nfic mRNA expression in dental papilla cells is elevated
            by the presence of Hertwig's epithelial root sheath cells.
REFERENCE   3  (bases 1 to 1565)
  AUTHORS   Lee HK, Lee DS, Park SJ, Cho KH, Bae HS and Park JC.
  TITLE     Nuclear factor I-C (NFIC) regulates dentin sialophosphoprotein
            (DSPP) and E-cadherin via control of Kruppel-like factor 4 (KLF4)
            during dentinogenesis
  JOURNAL   J Biol Chem 289 (41), 28225-28236 (2014)
   PUBMED   25138274
  REMARK    GeneRIF: NFIC regulates DSPP and E-cadherin via control of KLF4
            during dentinogenesis.
REFERENCE   4  (bases 1 to 1565)
  AUTHORS   Riffel AK, Schuenemann E and Vyhlidal CA.
  TITLE     Regulation of the CYP3A4 and CYP3A7 promoters by members of the
            nuclear factor I transcription factor family
  JOURNAL   Mol Pharmacol 76 (5), 1104-1114 (2009)
   PUBMED   19706729
REFERENCE   5  (bases 1 to 1565)
  AUTHORS   Royland JE and Kodavanti PR.
  TITLE     Gene expression profiles following exposure to a developmental
            neurotoxicant, Aroclor 1254: pathway analysis for possible mode(s)
            of action
  JOURNAL   Toxicol Appl Pharmacol 231 (2), 179-196 (2008)
   PUBMED   18602130
REFERENCE   6  (bases 1 to 1565)
  AUTHORS   Szpirer C, Van Vooren P, Riviere M, Scohy S, Collau G and Szpirer
            J.
  TITLE     Localization of 54 rat genes, and definition of new synteny groups
            conserved in the human and the rat
  JOURNAL   Mamm Genome 11 (9), 729-735 (2000)
   PUBMED   10967130
REFERENCE   7  (bases 1 to 1565)
  AUTHORS   Baumeister H, Gronostajski RM, Lyons GE and Margolis FL.
  TITLE     Identification of NFI-binding sites and cloning of NFI-cDNAs
            suggest a regulatory role for NFI transcription factors in
            olfactory neuron gene expression
  JOURNAL   Brain Res Mol Brain Res 72 (1), 65-79 (1999)
   PUBMED   10521600
REFERENCE   8  (bases 1 to 1565)
  AUTHORS   Osada S, Matsubara T, Daimon S, Terazu Y, Xu M, Nishihara T and
            Imagawa M.
  TITLE     Expression, DNA-binding specificity and transcriptional regulation
            of nuclear factor 1 family proteins from rat
  JOURNAL   Biochem J 342 (Pt 1) (Pt 1), 189-198 (1999)
   PUBMED   10432316
REFERENCE   9  (bases 1 to 1565)
  AUTHORS   Chaudhry AZ, Lyons GE and Gronostajski RM.
  TITLE     Expression patterns of the four nuclear factor I genes during mouse
            embryogenesis indicate a potential role in development
  JOURNAL   Dev Dyn 208 (3), 313-325 (1997)
   PUBMED   9056636
REFERENCE   10 (bases 1 to 1565)
  AUTHORS   Nehls MC, Grapilon ML and Brenner DA.
  TITLE     NF-I/Sp1 switch elements regulate collagen alpha 1(I) gene
            expression
  JOURNAL   DNA Cell Biol 11 (6), 443-452 (1992)
   PUBMED   1524678
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB012233.2.
            
            On or before May 24, 2007 this sequence version replaced
            XM_345789.3, XM_001075535.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB012233.2, SRR8487226.74840.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMD00132261, SAMD00132262
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1565
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="Sprague-Dawley"
                     /db_xref="taxon:10116"
                     /chromosome="7"
                     /map="7q11"
     gene            1..1565
                     /gene="Nfic"
                     /note="nuclear factor I/C"
                     /db_xref="GeneID:29228"
                     /db_xref="RGD:62016"
     CDS             1..1320
                     /gene="Nfic"
                     /note="olfactory epithelium nuclear factor I-C"
                     /codon_start=1
                     /product="nuclear factor 1 C-type"
                     /protein_id="NP_113755.1"
                     /db_xref="GeneID:29228"
                     /db_xref="RGD:62016"
                     /translation="

MYSSPLCLTQDEFHPFIEALLPHVRAFAYTWFNLQARKRKYFKKHEKRMSKDEERAVKDELLGEKAEVKQKWASRLLAKLRKDIRPECREDFVLAVTGKKAPGCVLSNPDQKGKMRRIDCLRQADKVWRLDLVMVILFKGIPLESTDGERLVKAAACAHPVLCVQPHHIGVAVKELDLYLAYFVRERDAEQSSSPRTGVGSDQEDSKPITLDTTDFQESFVTSGVFSVTELIQVSRTPVVTGTGPNFSLGELQGHLAYDLNPASAGMRRTLPSTSSSGSKRHKSGSMEEDVDTSPGGDYYTSPNSPTSSSRNWTEDMEGGISSPVKKTEMDKSPFNSPSPQDSPRLSSFTQHHRPVIAVHSGIARSPHPSSALHFPATPILPQTASTYFPHTAIRYPPHLNPQDPLKDLVSLACDPATQQPGPPALRPARPLQTVPLWD"

     misc_feature    28..141
                     /gene="Nfic"
                     /note="Nuclear factor I protein pre-N-terminus; Region:
                     NfI_DNAbd_pre-N; pfam10524"
                     /db_xref="CDD:463134"
     misc_feature    202..507
                     /gene="Nfic"
                     /note="N-terminal Mad Homology 1 (MH1) domain; Region:
                     MH1; cl00055"
                     /db_xref="CDD:469592"
     misc_feature    649..>1272
                     /gene="Nfic"
                     /note="CTF/NF-I family transcription modulation region;
                     Region: CTF_NFI; pfam00859"
                     /db_xref="CDD:459967"
     exon            1..30
                     /gene="Nfic"
                     /inference="alignment:Splign:2.1.0"
     exon            31..562
                     /gene="Nfic"
                     /inference="alignment:Splign:2.1.0"
     exon            563..634
                     /gene="Nfic"
                     /inference="alignment:Splign:2.1.0"
     exon            635..709
                     /gene="Nfic"
                     /inference="alignment:Splign:2.1.0"
     exon            710..833
                     /gene="Nfic"
                     /inference="alignment:Splign:2.1.0"
     exon            834..958
                     /gene="Nfic"
                     /inference="alignment:Splign:2.1.0"
     exon            959..1084
                     /gene="Nfic"
                     /inference="alignment:Splign:2.1.0"
     exon            1085..1269
                     /gene="Nfic"
                     /inference="alignment:Splign:2.1.0"
     exon            1270..1346
                     /gene="Nfic"
                     /inference="alignment:Splign:2.1.0"
     exon            1347..1565
                     /gene="Nfic"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atgtattcctccccgctctgcctgacccaggatgagttccacccattcatcgaggctctgctgccgcatgtgcgtgccttcgcctacacctggttcaacctgcaggcgcgcaagcgcaagtacttcaagaagcacgagaagcgcatgtcgaaggacgaggagcgcgcggtgaaggatgaactgctgggtgaaaaggccgaggtgaagcagaagtgggcgtcacggctgctggccaagctgcgcaaggacatccggcccgagtgccgcgaagacttcgtactggctgtgacaggcaagaaggcaccaggctgtgtgctgtccaacccggaccagaagggcaagatgcggcgcatcgactgcctgcgccaggctgacaaagtatggcgcctggacctggtcatggtcatcctgttcaagggtatcccactggagagcacggacggcgagcggctggtgaaggccgctgcctgcgcgcaccccgtgctgtgtgtgcagccgcaccatattggcgtggccgtcaaggagctggacctgtacctggcctacttcgtgcgggagcgcgatgcggagcagagcagcagtccccggacaggagtgggctcagaccaggaggacagcaagcccattacactggacacgacagacttccaggagagcttcgtcacatctggcgtgttcagtgtcacggagctgatccaggtgtctcggacacctgtggtgaccggaaccgggcccaacttctccctgggagagctgcagggccacctggcatacgacctgaacccagccagcgctggcatgagaaggactctacccagtacttcctccagtgggagcaagcggcacaagtcgggctcgatggaggaggacgtggacacgagccctggcggagactactacacatcacccaactcgcccacgagtagcagccgcaactggacggaagacatggaaggaggcatctcatccccggtgaagaagacagagatggacaaatctccattcaacagcccatccccccaggactccccccggctctccagcttcacacagcaccacaggcccgtcatcgcggtacacagcggcatcgcgcggagcccccacccgtcctcagccctgcacttccctgccacgcccatcctgccgcagacagcctccacctacttcccccacactgccatccggtacccgccacatctcaacccccaggacccactcaaggatctggtgtccctggcctgcgacccggccacccagcagccaggaccgcctgctctccgcccggcacgtcccctgcaaacagtccctttgtgggattaggacggagggatcctcttgcgggacagtcctggtacctggggtagcggaggttgccttcccacacctccttcatcgccggtggagtcccagggtgacagtcccagcctgcatttttggtggaaaattagacgagtgagaagtcccctgccaactcccagctcaatggcaatgacaggaggagaaaggacaaaagacaaacaagaaacaaaacccttcccaaccaagatgaaaacacatgggagctc

//