2024-04-25 22:31:41, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_024394 2002 bp mRNA linear ROD 21-NOV-2023 DEFINITION Rattus norvegicus 5-hydroxytryptamine receptor 3A (Htr3a), mRNA. ACCESSION NM_024394 VERSION NM_024394.3 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2002) AUTHORS Belliveau S, Kang W, Bovaird S, Hamadjida A, Bedard D, Dancause N, Stroh T and Huot P. TITLE Stereological investigation of 5-HT3 receptors in the substantia nigra and dorsal raphe nucleus in the rat JOURNAL J Chem Neuroanat 111, 101881 (2021) PUBMED 33160048 REMARK GeneRIF: Stereological investigation of 5-HT3 receptors in the substantia nigra and dorsal raphe nucleus in the rat. REFERENCE 2 (bases 1 to 2002) AUTHORS Domocos D, Selescu T, Ceafalan LC, Iodi Carstens M, Carstens E and Babes A. TITLE Role of 5-HT1A and 5-HT3 receptors in serotonergic activation of sensory neurons in relation to itch and pain behavior in the rat JOURNAL J Neurosci Res 98 (10), 1999-2017 (2020) PUBMED 32537854 REMARK GeneRIF: Role of 5-HT1A and 5-HT3 receptors in serotonergic activation of sensory neurons in relation to itch and pain behavior in the rat. Erratum:[J Neurosci Res. 2023 Jan;101(1):196. PMID: 36250251] REFERENCE 3 (bases 1 to 2002) AUTHORS Nakamori H, Naitou K, Sano Y, Shimaoka H, Shiina T and Shimizu Y. TITLE Exogenous serotonin regulates colorectal motility via the 5-HT2 and 5-HT3 receptors in the spinal cord of rats JOURNAL Neurogastroenterol Motil 30 (3) (2018) PUBMED 28795477 REMARK GeneRIF: Results demonstrate that exogenous serotonin acts on 5-HT2 and 5-HT3 receptors in the lumbosacral defecation center and activates the parasympathetic nervous system to enhance colorectal motility in cooperation with noradrenaline and dopamine. REFERENCE 4 (bases 1 to 2002) AUTHORS Imada T, Nakamura S, Hisamura R, Izuta Y, Jin K, Ito M, Kitamura N, Tanaka KF, Mimura M, Shibuya I and Tsubota K. TITLE Serotonin hormonally regulates lacrimal gland secretory function via the serotonin type 3a receptor JOURNAL Sci Rep 7 (1), 6965 (2017) PUBMED 28761086 REMARK GeneRIF: Results found that 5-HT3aR plays a role in lacrimal gland secretory functions and confirmed that extracellular Ca2+ entry participates in [Ca2+]i mobilization stimulated by 5-HT. Publication Status: Online-Only REFERENCE 5 (bases 1 to 2002) AUTHORS Pratt WE, Lin P, Pierce-Messick Z, Ilesanmi AO and Clissold KA. TITLE Contrasting effects of 5-HT3 receptor stimulation of the nucleus accumbens or ventral tegmentum on food intake in the rat JOURNAL Behav Brain Res 323, 15-23 (2017) PUBMED 28115218 REMARK GeneRIF: Data support a functional role for serotonergic signaling in the mesolimbic pathway on motivated behavior, and demonstrate that 5-HT3 serotonin receptors differentially modulate food consumption in a region-dependent manner. REFERENCE 6 (bases 1 to 2002) AUTHORS Hanna MC, Davies PA, Hales TG and Kirkness EF. TITLE Evidence for expression of heteromeric serotonin 5-HT(3) receptors in rodents JOURNAL J Neurochem 75 (1), 240-247 (2000) PUBMED 10854267 REFERENCE 7 (bases 1 to 2002) AUTHORS Davies PA, Pistis M, Hanna MC, Peters JA, Lambert JJ, Hales TG and Kirkness EF. TITLE The 5-HT3B subunit is a major determinant of serotonin-receptor function JOURNAL Nature 397 (6717), 359-363 (1999) PUBMED 9950429 REFERENCE 8 (bases 1 to 2002) AUTHORS Miyake A, Mochizuki S, Takemoto Y and Akuzawa S. TITLE Molecular cloning of human 5-hydroxytryptamine3 receptor: heterogeneity in distribution and function among species JOURNAL Mol Pharmacol 48 (3), 407-416 (1995) PUBMED 7565620 REFERENCE 9 (bases 1 to 2002) AUTHORS Miquel MC, Emerit MB, Gingrich JA, Nosjean A, Hamon M and el Mestikawy S. TITLE Developmental changes in the differential expression of two serotonin 5-HT3 receptor splice variants in the rat JOURNAL J Neurochem 65 (2), 475-483 (1995) PUBMED 7616200 REFERENCE 10 (bases 1 to 2002) AUTHORS Isenberg KE, Ukhun IA, Holstad SG, Jafri S, Uchida U, Zorumski CF and Yang J. TITLE Partial cDNA cloning and NGF regulation of a rat 5-HT3 receptor subunit JOURNAL Neuroreport 5 (2), 121-124 (1993) PUBMED 7509203 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JACYVU010000198.1. On Nov 27, 2020 this sequence version replaced NM_024394.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support SAMD00132261, SAMD00132262 [ECO:0000350] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-176 JACYVU010000198.1 11067525-11067700 c 177-343 JACYVU010000198.1 11065164-11065330 c 344-388 JACYVU010000198.1 11063953-11063997 c 389-498 JACYVU010000198.1 11062880-11062989 c 499-668 JACYVU010000198.1 11061009-11061178 c 669-829 JACYVU010000198.1 11057822-11057982 c 830-1040 JACYVU010000198.1 11057285-11057495 c 1041-1262 JACYVU010000198.1 11056612-11056833 c 1263-2002 JACYVU010000198.1 11055331-11056070 c FEATURES Location/Qualifiers source 1..2002 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="8" /map="8q23" gene 1..2002 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /note="5-hydroxytryptamine receptor 3A" /db_xref="GeneID:79246" /db_xref="RGD:61818" exon 1..176 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /inference="alignment:Splign:2.1.0" misc_feature 20..22 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /note="upstream in-frame stop codon" CDS 110..1561 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /note="5-HT3 receptor; 5-HT-3; 5-HT3R; serotonin receptor 3A; serotonin-gated ion channel receptor; 5-HT3-A; 5-hydroxytryptamine receptor 3; 5-hydroxytryptamine (serotonin) receptor 3A, ionotropic" /codon_start=1 /product="5-hydroxytryptamine receptor 3A precursor" /protein_id="NP_077370.2" /db_xref="GeneID:79246" /db_xref="RGD:61818" /translation="
MPLCIPQVLLALFLSVLIAQGEGSRRRATQAHSTTQPALLRLSDHLLANYKKGVRPVRDWRKPTLVSIDVIMYAILNVDEKNQVLTTYIWYRQFWTDEFLQWTPEDFDNVTKLSIPTDSIWVPDILINEFVDVGKSPSIPYVYVHHQGEVQNYKPLQLVTACSLDIYNFPFDVQNCSLTFTSWLHTIQDINISLWRTPEEVRSDKSIFINQGEWELLGVFTKFQEFSIETSNSYAEMKFYVVIRRRPLFYAVSLLLPSIFLMVVDIVGFCLPPDSGERVSFKITLLLGYSVFLIIVSDTLPATAIGTPLIGVYFVVCMALLVISLAETIFIVQLVHKQDLQRPVPDWLRHLVLDRIAWLLCLGEQPMAHRPPATFQANKTDDCSAMGNHCSHVGSPQDLEKTSRSRDSPLPPPREASLAVRGLLQELSSIRHSLEKRDEMREVARDWLRVGYVLDRLLFRIYLLAVLAYSITLVTLWSIWHYS"
sig_peptide 110..178 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /inference="COORDINATES: ab initio prediction:SignalP:4.0" misc_feature 122..1540 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /note="Cation transporter family protein; Region: LIC; TIGR00860" /db_xref="CDD:273305" mat_peptide 179..1558 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /product="5-hydroxytryptamine receptor 3A. /id=PRO_0000000410" /note="propagated from UniProtKB/Swiss-Prot (P35563.2)" misc_feature 434..436 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (P35563.2); glycosylation site" misc_feature 632..634 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (P35563.2); glycosylation site" misc_feature 680..682 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (P35563.2); glycosylation site" misc_feature 848..928 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /note="propagated from UniProtKB/Swiss-Prot (P35563.2); transmembrane region" misc_feature 944..1000 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /note="propagated from UniProtKB/Swiss-Prot (P35563.2); transmembrane region" misc_feature 1031..1087 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /note="propagated from UniProtKB/Swiss-Prot (P35563.2); transmembrane region" misc_feature 1286..1351 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /note="propagated from UniProtKB/Swiss-Prot (P35563.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 1364..1474 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /note="propagated from UniProtKB/Swiss-Prot (P35563.2); Region: HA-stretch, determines single-channel conductance in 5-HT3 receptors. /evidence=ECO:0000250|UniProtKB:P46098" misc_feature 1490..1549 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /note="propagated from UniProtKB/Swiss-Prot (P35563.2); transmembrane region" exon 177..343 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /inference="alignment:Splign:2.1.0" exon 344..388 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /inference="alignment:Splign:2.1.0" exon 389..498 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /inference="alignment:Splign:2.1.0" exon 499..668 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /inference="alignment:Splign:2.1.0" exon 669..829 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /inference="alignment:Splign:2.1.0" exon 830..1040 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /inference="alignment:Splign:2.1.0" exon 1041..1262 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /inference="alignment:Splign:2.1.0" exon 1263..2002 /gene="Htr3a" /gene_synonym="5-HT3; 5-HT3A; 5HT3; Htr3" /inference="alignment:Splign:2.1.0" ORIGIN
aagcagcctgcctgggacatgaggttggcagcgggtgtgcaggctggcagtctgggggactcatcctgagtggctgctccgaggccctcccacatccgggaagcttgccatgccgctctgcatcccgcaggtgctgttggccttgttcctttccgtgctgatagcccagggagaaggcagccggaggagggccacccaggcccacagcaccacccagcctgctctgctgaggctgtcagatcacctcctggctaactacaagaagggggtgcggcctgtgcgggactggaggaagcccaccctggtctccatcgatgtcatcatgtatgccatcctcaacgtggatgagaagaaccaggttctgacaacctacatatggtaccggcagttctggaccgacgagtttctacagtggactcctgaggacttcgacaatgtcaccaaattgtccatccccaccgacagcatctgggtccctgacatcctcatcaatgagtttgtggacgtggggaagtctccaagcattccttatgtgtatgtgcaccatcaaggtgaagtccagaactacaagcccctacagctggtgaccgcctgtagccttgacatctataacttcccgttcgatgtgcagaactgctctctgaccttcaccagctggctgcataccatccaggacatcaacatttccctgtggcgaacaccagaagaagtgaggtcggacaagagcatcttcataaatcagggcgagtgggagctgctgggggtgttcaccaaatttcaggagttcagtatagaaaccagtaacagctatgcggaaatgaagttctacgtggtcatccgccggcggcctttattctacgcagtcagcctcttgctgcccagtatcttcctcatggttgtggacattgtgggcttttgtctgcccccggacagtggtgagagagtgtctttcaagatcacgctccttctgggatactcagtctttctcatcatcgtgtcagacacactgcctgcaacggccatcggcactcccctcattggtgtctactttgtagtgtgcatggctctgctggtgataagcctcgctgagaccatcttcattgtgcagctggtgcataagcaggatttacagcgccctgtacctgactggctgaggcacctggtcctagacagaatagcctggctgctctgcctaggggagcagcccatggcccataggcccccagccaccttccaagccaacaagactgatgactgctcagccatgggaaaccactgcagccatgtcggaagccctcaggacttggagaagacctcgaggagcagagatagccctcttccaccaccaagggaggcctcgctggctgtgcgtggcctcttgcaagagctgtcctccatccgccactccctggagaagcgggatgagatgcgggaggtggcaagggactggttgcgggtgggatatgtgctggacaggctgctgtttcgcatctacctgctggccgtgctggcttacagcatcaccctggtcacgctctggtccatttggcattattcctgagtgggtacagcctggcagggaggggatgtgagtcctgcatcctgtttccaacaccaattcatctgagcaaccccagtccccttgtcccctaaacttagcactgaagacccggtcagaccccccgacttcgctatcatgactttaaagcatgatatcctagatcaagaggaaccaagactcctctaacttattaagacatcaagccctggttccttttccagtacttctgtgattatggcccttgggatggctcatttccacagttttttttttcctttttgatcagaggaaagcaaattctcttgcctaggtgcctgagacgtctgtgcctgttttatccaggccccagtggcttcttcttcagctcacttgtgggtacttccctagcgctcagcctcatcaaccaacggggggagggaataataaaatgctatgatatcc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]