GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-28 22:26:19, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_019264               1541 bp    mRNA    linear   ROD 22-MAR-2023
DEFINITION  Rattus norvegicus protein kinase cAMP-dependent type II regulatory
            subunit alpha (Prkar2a), mRNA.
ACCESSION   NM_019264
VERSION     NM_019264.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1541)
  AUTHORS   Isensee J, Kaufholz M, Knape MJ, Hasenauer J, Hammerich H,
            Gonczarowska-Jorge H, Zahedi RP, Schwede F, Herberg FW and Hucho T.
  TITLE     PKA-RII subunit phosphorylation precedes activation by cAMP and
            regulates activity termination
  JOURNAL   J Cell Biol 217 (6), 2167-2184 (2018)
   PUBMED   29615473
  REMARK    GeneRIF: RII phosphorylation precedes cAMP binding and controls the
            inactivation by modulating the reassociation involving the
            coordinated action of phosphodiesterases and phosphatases.
REFERENCE   2  (bases 1 to 1541)
  AUTHORS   Burgers PP, van der Heyden MA, Kok B, Heck AJ and Scholten A.
  TITLE     A systematic evaluation of protein kinase A-A-kinase anchoring
            protein interaction motifs
  JOURNAL   Biochemistry 54 (1), 11-21 (2015)
   PUBMED   25097019
REFERENCE   3  (bases 1 to 1541)
  AUTHORS   Nishimura T, Fujii W, Sugiura K and Naito K.
  TITLE     Cytoplasmic anchoring of cAMP-dependent protein kinase (PKA) by
            A-kinase anchor proteins (AKAPs) is required for meiotic arrest of
            porcine full-grown and growing oocytes
  JOURNAL   Biol Reprod 90 (3), 58 (2014)
   PUBMED   24501172
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1541)
  AUTHORS   Biesemann C, Gronborg M, Luquet E, Wichert SP, Bernard V, Bungers
            SR, Cooper B, Varoqueaux F, Li L, Byrne JA, Urlaub H, Jahn O, Brose
            N and Herzog E.
  TITLE     Proteomic screening of glutamatergic mouse brain synaptosomes
            isolated by fluorescence activated sorting
  JOURNAL   EMBO J 33 (2), 157-170 (2014)
   PUBMED   24413018
REFERENCE   5  (bases 1 to 1541)
  AUTHORS   Nishimura T, Sugiura K and Naito K.
  TITLE     A-kinase anchor protein 1 (AKAP1) regulates cAMP-dependent protein
            kinase (PKA) localization and is involved in meiotic maturation of
            porcine oocytes
  JOURNAL   Biol Reprod 88 (4), 85 (2013)
   PUBMED   23426434
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1541)
  AUTHORS   Kultgen PL, Byrd SK, Ostrowski LE and Milgram SL.
  TITLE     Characterization of an A-kinase anchoring protein in human ciliary
            axonemes
  JOURNAL   Mol Biol Cell 13 (12), 4156-4166 (2002)
   PUBMED   12475942
REFERENCE   7  (bases 1 to 1541)
  AUTHORS   Dwivedi Y, Rizavi HS and Pandey GN.
  TITLE     Differential effects of haloperidol and clozapine on [(3)H]cAMP
            binding, protein kinase A (PKA) activity, and mRNA and protein
            expression of selective regulatory and catalytic subunit isoforms
            of PKA in rat brain
  JOURNAL   J Pharmacol Exp Ther 301 (1), 197-209 (2002)
   PUBMED   11907174
REFERENCE   8  (bases 1 to 1541)
  AUTHORS   Marx SO, Reiken S, Hisamatsu Y, Jayaraman T, Burkhoff D, Rosemblit
            N and Marks AR.
  TITLE     PKA phosphorylation dissociates FKBP12.6 from the calcium release
            channel (ryanodine receptor): defective regulation in failing
            hearts
  JOURNAL   Cell 101 (4), 365-376 (2000)
   PUBMED   10830164
REFERENCE   9  (bases 1 to 1541)
  AUTHORS   Feliciello A, Cardone L, Garbi C, Ginsberg MD, Varrone S, Rubin CS,
            Avvedimento EV and Gottesman ME.
  TITLE     Yotiao protein, a ligand for the NMDA receptor, binds and targets
            cAMP-dependent protein kinase II(1)
  JOURNAL   FEBS Lett 464 (3), 174-178 (1999)
   PUBMED   10618500
REFERENCE   10 (bases 1 to 1541)
  AUTHORS   Scott,J.D., Glaccum,M.B., Zoller,M.J., Uhler,M.D., Helfman,D.M.,
            McKnight,G.S. and Krebs,E.G.
  TITLE     The molecular cloning of a type II regulatory subunit of the
            cAMP-dependent protein kinase from rat skeletal muscle and mouse
            brain
  JOURNAL   Proc Natl Acad Sci U S A 84 (15), 5192-5196 (1987)
   PUBMED   3037538
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF533978.1.
            
            On Aug 31, 2012 this sequence version replaced NM_019264.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF533978.1, J02934.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMD00132261, SAMD00132262
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1541              AF533978.1         5-1545
FEATURES             Location/Qualifiers
     source          1..1541
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="Sprague-Dawley"
                     /db_xref="taxon:10116"
                     /chromosome="8"
                     /map="8q32"
     gene            1..1541
                     /gene="Prkar2a"
                     /note="protein kinase cAMP-dependent type II regulatory
                     subunit alpha"
                     /db_xref="GeneID:29699"
                     /db_xref="RGD:3393"
     exon            1..365
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    44..46
                     /gene="Prkar2a"
                     /note="upstream in-frame stop codon"
     CDS             110..1315
                     /gene="Prkar2a"
                     /EC_number="2.7.11.1"
                     /note="protein kinase, cAMP-dependent, regulatory subunit
                     type II alpha; protein kinase, cAMP-dependent, regulatory,
                     type 2, alpha; protein kinase cAMP-dependent type 2
                     regulatory subunit alpha; protein kinase, cAMP dependent
                     regulatory, type II alpha"
                     /codon_start=1
                     /product="cAMP-dependent protein kinase type II-alpha
                     regulatory subunit"
                     /protein_id="NP_062137.1"
                     /db_xref="GeneID:29699"
                     /db_xref="RGD:3393"
                     /translation="
MSHIQIPPGLTELLQGYTVEVLRQQPPDLVDFAVEYFTRLREARRQESDSFIAPPTTFHAQESSGVPVIEEDGESESDSDDEDLEVPIPSKFTRRVSVCAETFNPDEEEDNDPRVVHPKTDEQRYRLQEACKDILLFKNLDQEQLSQVLDAMFEKIVKTDEHVIDQGDDGDNFYVIERGTYDILVTKDNQTRSVGQYDNRGSFGELALMYNTPRAATIVATSDGSLWGLDRVTFRRIIVKNNAKKRKMFESFIESVPLFKSLEMSERMKIVDVIGEKIYKDGERIITQGEKADSFYIIESGEVSILIRSKTKTNKNGGNQEVEIAHCHKGQYFGELALVTNKPRAASAYAVGDVKCLVMDVQAFERLLGPCMDIMKRNISHYEEQLVKMFGSNLDLLDPGQ"
     misc_feature    113..514
                     /gene="Prkar2a"
                     /note="propagated from UniProtKB/Swiss-Prot (P12368.4);
                     Region: Dimerization and phosphorylation"
     misc_feature    113..115
                     /gene="Prkar2a"
                     /note="N-acetylserine.
                     /evidence=ECO:0000250|UniProtKB:P13861; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); acetylation site"
     misc_feature    119..241
                     /gene="Prkar2a"
                     /note="dimerization/docking (D/D) domain of the Type II
                     alpha Regulatory subunit of cAMP-dependent protein kinase;
                     Region: DD_RIIalpha_PKA; cd12103"
                     /db_xref="CDD:438524"
     misc_feature    order(119..133,137..139,146..151,158..163,170..175,
                     182..184,191..202,206..211,218..223,227..232)
                     /gene="Prkar2a"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:438524"
     misc_feature    order(125..127,137..142,149..154,161..166,173..178)
                     /gene="Prkar2a"
                     /note="AKAP interaction site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:438524"
     misc_feature    251..253
                     /gene="Prkar2a"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P13861; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     misc_feature    272..364
                     /gene="Prkar2a"
                     /note="propagated from UniProtKB/Swiss-Prot (P12368.4);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    332..334
                     /gene="Prkar2a"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P13861; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     misc_feature    338..340
                     /gene="Prkar2a"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P13861; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     misc_feature    398..400
                     /gene="Prkar2a"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:16641100,
                     ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     misc_feature    515..853
                     /gene="Prkar2a"
                     /note="effector domain of the CAP family of transcription
                     factors; members include CAP (or cAMP receptor protein
                     (CRP)), which binds cAMP, FNR (fumarate and nitrate
                     reduction), which uses an iron-sulfur cluster to sense
                     oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
                     cd00038"
                     /db_xref="CDD:237999"
     misc_feature    order(719..724,749..757)
                     /gene="Prkar2a"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:237999"
     misc_feature    743..745
                     /gene="Prkar2a"
                     /note="Phosphothreonine, by PDPK1.
                     /evidence=ECO:0000250|UniProtKB:P00515; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     misc_feature    order(815..823,833..841)
                     /gene="Prkar2a"
                     /note="flexible hinge region; other site"
                     /db_xref="CDD:237999"
     misc_feature    881..1246
                     /gene="Prkar2a"
                     /note="effector domain of the CAP family of transcription
                     factors; members include CAP (or cAMP receptor protein
                     (CRP)), which binds cAMP, FNR (fumarate and nitrate
                     reduction), which uses an iron-sulfur cluster to sense
                     oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
                     cd00038"
                     /db_xref="CDD:237999"
     misc_feature    order(1109..1114,1139..1147)
                     /gene="Prkar2a"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:237999"
     misc_feature    1148..1150
                     /gene="Prkar2a"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P13861; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     misc_feature    order(1205..1213,1223..1231)
                     /gene="Prkar2a"
                     /note="flexible hinge region; other site"
                     /db_xref="CDD:237999"
     misc_feature    1283..1285
                     /gene="Prkar2a"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P12368.4); phosphorylation site"
     exon            366..401
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            402..451
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            452..535
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            536..642
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            643..796
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            797..898
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            899..973
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            974..1039
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1040..1181
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1182..1541
                     /gene="Prkar2a"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
cgggccgcgcgggagacctcgggcgcggagtgactggccggcgtgagggagcgcgcaggttgcggccgccggcggccccgacccgccggccctctcagcggtcgccggcatgagccacatccagatcccaccggggctcacggagctgctgcagggctacaccgtggaggtgcttcggcagcagccgcccgacctcgtcgacttcgcggtggagtacttcacacgcctgcgcgaggcccgccgccaggaatcagactcgttcatcgcccccccgacgacctttcacgcgcaggagtccagcggggtccccgtcatcgaggaggacggggagagtgaatcggactcggacgatgaggatctggaagttccgattcccagcaaatttactagacgagtatcagtctgtgcagaaacgtttaaccctgatgaagaagaagataatgatccaagggtggttcaccccaaaaccgacgagcagaggtacagacttcaggaagcctgtaaagacattctgcttttcaaaaacctggatcaggaacagctttctcaagttctggacgccatgtttgaaaagatagtcaaaactgacgagcatgtcattgaccaaggagatgatggagacaacttttatgtcatagaaaggggaacctatgacattttagtaacaaaagataatcaaacacgatctgttggtcagtatgacaaccgtggcagttttggagaactagccctgatgtacaataccccgagagctgctaccattgtggccacctcagacggctccctttggggattggaccgggtgacttttaggagaatcatagtgaagaacaatgcaaagaagaggaagatgttcgaatcgtttattgagtctgtaccgctctttaaatcactagagatgtcagaacgaatgaagattgtggatgtgatcggggaaaagatctataaggatggagagcgaataatcactcagggtgaaaaggccgacagcttttatattatagagtctggagaagtgagcatcttgattagaagcaagactaaaacgaacaagaacggcgggaaccaggaggttgagattgcccactgccataaggggcagtactttggagaacttgccctggtgaccaacaaaccaagagctgcttctgcttatgcggttggagacgtcaaatgcttagtcatggatgttcaagcatttgagaggcttctgggcccctgcatggacatcatgaagaggaacatctcacattacgaagaacagctggtgaagatgtttggctccaacttggatctattggaccccgggcagtagatgtgatgaatctcggagccttctcagtgtgataccaaatccttccagtcagccacaagaacacacccagaaaacagacacgacagaactgcgcctgctgctgtctctgctgctgccatcgctgtggtaaagggcacttagaagtcttgaaagatggacagaggctctacccacacccaccttccactttgcttctgaacgccgtcattagaccacttatgtcacg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]