2025-07-16 04:10:04, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001433273 718 bp mRNA linear ROD 08-AUG-2024 DEFINITION Rattus norvegicus reproductive homeobox 9 like 1 (Rhox9l1), transcript variant 2, mRNA. ACCESSION NM_001433273 VERSION NM_001433273.1 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 718) AUTHORS Borgmann,J., Tuttelmann,F., Dworniczak,B., Ropke,A., Song,H.W., Kliesch,S., Wilkinson,M.F., Laurentino,S. and Gromoll,J. TITLE The human RHOX gene cluster: target genes and functional analysis of gene variants in infertile men JOURNAL Hum Mol Genet 25 (22), 4898-4910 (2016) PUBMED 28171660 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAXUCZ010000021.1. ##Evidence-Data-START## Transcript exon combination :: AW921168.1 [ECO:0000332] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-109 JAXUCZ010000021.1 121425885-121425993 110-141 JAXUCZ010000021.1 121426178-121426209 142-437 JAXUCZ010000021.1 121426342-121426637 438-483 JAXUCZ010000021.1 121427262-121427307 484-718 JAXUCZ010000021.1 121428209-121428443 FEATURES Location/Qualifiers source 1..718 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="X" /map="Xq35" gene 1..718 /gene="Rhox9l1" /gene_synonym="Psx3" /note="reproductive homeobox 9 like 1" /db_xref="GeneID:100364002" /db_xref="RGD:2321855" exon 1..109 /gene="Rhox9l1" /gene_synonym="Psx3" /inference="alignment:Splign:2.1.0" CDS 28..579 /gene="Rhox9l1" /gene_synonym="Psx3" /note="isoform 2 is encoded by transcript variant 2; rhox homeobox family member 2-like; homeobox protein PSX3; reproductive homeobox 9-like" /codon_start=1 /product="reproductive homeobox 9 like 1 isoform 2" /protein_id="NP_001420202.1" /db_xref="GeneID:100364002" /db_xref="RGD:2321855" /translation="
MDTPQDSCQSFQKSLSLGAEVDPEQQHGGTAVVSEAREDATGVGEEGDEKEEEMEARYAGDGAYGPEDNNVQQEGDQHPNDQEQPQQEAAIPEGSRGQQAGNNLAHPRYSRTRFTPSQLRDLERLFQETRYPSLRTRKDIARWMGVEECDVQNWFRMRRSLFQRSRRVLLLCTLQPFPQNNSS"
misc_feature 349..519 /gene="Rhox9l1" /gene_synonym="Psx3" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 110..141 /gene="Rhox9l1" /gene_synonym="Psx3" /inference="alignment:Splign:2.1.0" exon 142..437 /gene="Rhox9l1" /gene_synonym="Psx3" /inference="alignment:Splign:2.1.0" exon 438..483 /gene="Rhox9l1" /gene_synonym="Psx3" /inference="alignment:Splign:2.1.0" exon 484..718 /gene="Rhox9l1" /gene_synonym="Psx3" /inference="alignment:Splign:2.1.0" ORIGIN
gcaaggtcagatccagtgattttcgccatggacactcctcaagacagctgccaaagtttccaaaagtctctgagtctgggagctgaggtggacccggagcaacagcatggtgggactgcagtggtctcagaggctagagaggacgccacaggagtaggagaggagggagacgagaaggaagaagaaatggaagcaagatatgctggtgatggtgcttacggccccgaggacaacaacgtccagcaagaaggtgaccaacaccccaatgatcaagagcagcctcagcaagaggcagccattcctgagggcagcaggggtcaacaggctgggaacaacttggctcacccgcggtacagtcgcacgaggttcaccccgtctcagctgcgtgatctggagcgcctgttccaagagactcgctaccccagcttgcgaacaaggaaggacatcgcacgatggatgggagtggaggaatgtgatgtgcagaattggttccggatgagaagatctcttttccagagaagcaggagagtgctgcttctctgcactctgcaaccatttccccagaacaactcttcctgaagattttggagcagcacttgagtgccaacgcctgtcccagagccacatgaggaaggcttcttctgagccacccataatggccatgactacctttacttccctacagttatttgagcaataaagacgtggattctaagta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]