ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-17 15:42:38, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001427140 2160 bp mRNA linear ROD 03-APR-2024
DEFINITION Rattus norvegicus RELB proto-oncogene, NF-kB subunit (Relb), mRNA.
ACCESSION NM_001427140 XM_006228502
VERSION NM_001427140.1
KEYWORDS RefSeq; RefSeq Select.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 2160)
AUTHORS Qiu,J., Yuan,H., Chen,S., Zhou,Y., Song,D. and Chen,R.
TITLE TNFalpha up-regulates COX-2 in chronic progressive nephropathy
through nuclear accumulation of RelB and NF-kappaB2
JOURNAL Arch Physiol Biochem 122 (2), 88-93 (2016)
PUBMED 26824492
REMARK GeneRIF: TNFalpha-RelB/p52 pathway may be involved in the early
stages of renal damage, in part by stimulating COX-2 and
inflammatory responses
REFERENCE 2 (bases 1 to 2160)
AUTHORS Sharfe,N., Merico,D., Karanxha,A., Macdonald,C., Dadi,H., Ngan,B.,
Herbrick,J.A. and Roifman,C.M.
TITLE The effects of RelB deficiency on lymphocyte development and
function
JOURNAL J Autoimmun 65, 90-100 (2015)
PUBMED 26385063
REFERENCE 3 (bases 1 to 2160)
AUTHORS Li,Y., Xie,J., Xu,X., Liu,L., Wan,Y., Liu,Y., Zhu,C. and Zhu,Y.
TITLE Inducible interleukin 32 (IL-32) exerts extensive antiviral
function via selective stimulation of interferon lambda1
(IFN-lambda1)
JOURNAL J Biol Chem 288 (29), 20927-20941 (2013)
PUBMED 23729669
REFERENCE 4 (bases 1 to 2160)
AUTHORS Vogel,K.U., Edelmann,S.L., Jeltsch,K.M., Bertossi,A., Heger,K.,
Heinz,G.A., Zoller,J., Warth,S.C., Hoefig,K.P., Lohs,C., Neff,F.,
Kremmer,E., Schick,J., Repsilber,D., Geerlof,A., Blum,H., Wurst,W.,
Heikenwalder,M., Schmidt-Supprian,M. and Heissmeyer,V.
TITLE Roquin paralogs 1 and 2 redundantly repress the Icos and Ox40
costimulator mRNAs and control follicular helper T cell
differentiation
JOURNAL Immunity 38 (4), 655-668 (2013)
PUBMED 23583643
REFERENCE 5 (bases 1 to 2160)
AUTHORS Xie,J., Wang,Y., Bao,J., Ma,Y., Zou,Z., Tang,Z., Dong,R. and Wen,H.
TITLE Immune tolerance induced by RelB short-hairpin RNA interference
dendritic cells in liver transplantation
JOURNAL J Surg Res 180 (1), 169-175 (2013)
PUBMED 23196258
REFERENCE 6 (bases 1 to 2160)
AUTHORS Bieg,S., Simonson,W., Ellefsen,K. and Lernmark,A.
TITLE Rel B is an early marker of autoimmune islet inflammation in the
biobreeding (BB) rat
JOURNAL Pancreas 20 (1), 47-54 (2000)
PUBMED 10630383
REFERENCE 7 (bases 1 to 2160)
AUTHORS Kurt,R.A., Urba,W.J., Smith,J.W. and Schoof,D.D.
TITLE Peripheral T lymphocytes from women with breast cancer exhibit
abnormal protein expression of several signaling molecules
JOURNAL Int J Cancer 78 (1), 16-20 (1998)
PUBMED 9724088
REFERENCE 8 (bases 1 to 2160)
AUTHORS Morrissey,J.J. and Klahr,S.
TITLE Rapid communication. Enalapril decreases nuclear factor kappa B
activation in the kidney with ureteral obstruction
JOURNAL Kidney Int 52 (4), 926-933 (1997)
PUBMED 9328931
REFERENCE 9 (bases 1 to 2160)
AUTHORS Burkly,L., Hession,C., Ogata,L., Reilly,C., Marconi,L.A., Olson,D.,
Tizard,R., Cate,R. and Lo,D.
TITLE Expression of relB is required for the development of thymic
medulla and dendritic cells
JOURNAL Nature 373 (6514), 531-536 (1995)
PUBMED 7845467
REFERENCE 10 (bases 1 to 2160)
AUTHORS Dobrzanski,P., Ryseck,R.P. and Bravo,R.
TITLE Both N- and C-terminal domains of RelB are required for full
transactivation: role of the N-terminal leucine zipper-like motif
JOURNAL Mol Cell Biol 13 (3), 1572-1582 (1993)
PUBMED 8441398
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
JAXUCZ010000001.1.
On Jan 10, 2024 this sequence version replaced XM_006228502.4.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: SRR22582416.1146208.1,
SRR21887623.631676.1 [ECO:0000332]
RNAseq introns :: mixed sample support SAMEA5760383,
SAMEA5760386 [ECO:0006172]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on single protein-coding transcript
##RefSeq-Attributes-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-211 JAXUCZ010000001.1 88413170-88413380 c
212-262 JAXUCZ010000001.1 88412055-88412105 c
263-591 JAXUCZ010000001.1 88401929-88402257 c
592-749 JAXUCZ010000001.1 88399815-88399972 c
750-841 JAXUCZ010000001.1 88398411-88398502 c
842-973 JAXUCZ010000001.1 88397240-88397371 c
974-1078 JAXUCZ010000001.1 88395204-88395308 c
1079-1294 JAXUCZ010000001.1 88393727-88393942 c
1295-1363 JAXUCZ010000001.1 88392988-88393056 c
1364-1441 JAXUCZ010000001.1 88392794-88392871 c
1442-2160 JAXUCZ010000001.1 88385717-88386435 c
FEATURES Location/Qualifiers
source 1..2160
/organism="Rattus norvegicus"
/mol_type="mRNA"
/strain="BN"
/db_xref="taxon:10116"
/chromosome="1"
/map="1q21"
gene 1..2160
/gene="Relb"
/note="RELB proto-oncogene, NF-kB subunit"
/db_xref="GeneID:100360982"
/db_xref="RGD:2321078"
exon 1..211
/gene="Relb"
/inference="alignment:Splign:2.1.0"
CDS 160..1830
/gene="Relb"
/note="avian reticuloendotheliosis viral (v-rel) oncogene
related B; v-rel reticuloendotheliosis viral oncogene
homolog B; v-rel avian reticuloendotheliosis viral
oncogene homolog B"
/codon_start=1
/product="transcription factor RelB"
/protein_id="NP_001414069.1"
/db_xref="GeneID:100360982"
/db_xref="RGD:2321078"
/translation="
MPSRRAARESAPELGALGLRLPGSSDIPSLSRTTEIIDEYIKENGFGLDGAQLSEMPRLVPRGPASLSSVTLGPAAPPPPATPPWNCTLGRLVSPGPCPRPYLVITEQPKQRGMRFRYECEGRSAGSILGESSTEASKTLPAIELRDCGGLREVEVTACLVWKDWPHRVHPHSLVGKDCTDGVCRVRLRPHVSPRHSFNNLGIQCVRKKEIEAAIERKIQLGIDPYNAGSLKNHQEVDMNVVRICFQASYRDQQGHLHRMDPILSEPVYDKKSTNTSELRICRINKESGPCTGGEELYLLCDKVQKEDISVVFSTASWEGRADFSQADVHRQIAIVFKTPPYEDLEISEPVTVNVFLQRLTDGVCSEPLPFTYLPRDHDSYGVDKKRKRGLPDVLGELSSSDPHGIESKRRKKKPVFLDHFLPGHSSGLFLPPSALQSADTDFFPGTISLPGLEPPGGPDLLDDGFAYDPSAPTLFTMLDLLPPAPPLASAVVGNGGAGATVVESPGPEPLSLDSFAAPGPGDVGTASLVGSNMFPNQYREAAFGGGLLSPGPEAT"
misc_feature 160..381
/gene="Relb"
/note="RelB leucine zipper; Region: RelB_leu_zip;
pfam16180"
/db_xref="CDD:374415"
misc_feature 460..975
/gene="Relb"
/note="N-terminal sub-domain of the Rel homology domain
(RHD) of the reticuloendotheliosis viral oncogene homolog
B (RelB) protein; Region: RHD-n_RelB; cd07886"
/db_xref="CDD:143646"
misc_feature order(502..504,508..513,517..522,526..528,532..534,
538..540,778..786)
/gene="Relb"
/note="DNA binding site [nucleotide binding]"
/db_xref="CDD:143646"
misc_feature 997..1287
/gene="Relb"
/note="Rel homology dimerization domain; Region:
RHD_dimer; pfam16179"
/db_xref="CDD:465045"
misc_feature 1294..1827
/gene="Relb"
/note="RelB transactivation domain; Region:
RelB_transactiv; pfam16181"
/db_xref="CDD:406565"
exon 212..262
/gene="Relb"
/inference="alignment:Splign:2.1.0"
exon 263..591
/gene="Relb"
/inference="alignment:Splign:2.1.0"
exon 592..749
/gene="Relb"
/inference="alignment:Splign:2.1.0"
exon 750..841
/gene="Relb"
/inference="alignment:Splign:2.1.0"
exon 842..973
/gene="Relb"
/inference="alignment:Splign:2.1.0"
exon 974..1078
/gene="Relb"
/inference="alignment:Splign:2.1.0"
exon 1079..1294
/gene="Relb"
/inference="alignment:Splign:2.1.0"
exon 1295..1363
/gene="Relb"
/inference="alignment:Splign:2.1.0"
exon 1364..1441
/gene="Relb"
/inference="alignment:Splign:2.1.0"
exon 1442..2160
/gene="Relb"
/inference="alignment:Splign:2.1.0"
ORIGIN
gggcgccgtgcgtccaacccggccttcggccctatccttgcgcggcttccccggccggtgatcgtcccaacagactgggctgtccggctgcccggcttgccctcgtgcgcgcttcgccctgagcttgcctttgggctgtcggtccctacgggccgggccatgccgagtcgccgcgctgccagagagtccgcgcccgagctaggggccttgggtctccgtctcccaggttccagtgacatcccttcgctgtccaggaccacagaaatcatcgacgaatatattaaggagaacggcttcggcctggacggggcacagctgagtgagatgcctcgtctggtgccccgcgggccggcctcactgagcagcgtcactctgggcccagctgcaccaccgcctcctgccacgccgccctggaactgcacactgggcaggctggtatcacccggcccatgcccacggccatacttggtcatcacagagcagccaaagcagcgtggcatgcgcttccgctacgagtgcgagggtcgctcggctggcagcatcctcggggagagcagcactgaagccagcaagactctgcccgccatcgagcttcgagactgtggcgggctgcgggaggtggaggtgacggcgtgcctggtgtggaaggactggccacaccgggtacacccacacagccttgtggggaaagactgcacggacggcgtctgcagggtgcggctgcggcctcacgtcagcccccggcacagctttaacaacttgggcatccagtgtgttaggaagaaggaaatcgaagctgccattgagcgtaagatccagctgggaattgacccctacaatgctggctccctgaagaaccatcaggaggtcgacatgaatgttgtcaggatctgcttccaggcctcctatcgcgaccagcagggacatttgcaccgcatggaccccattctctctgagcctgtctacgacaagaagtccaccaacacctctgagctgcggatttgccgaatcaacaaggagagcgggccatgcacaggtggtgaggagctgtacttgctatgtgacaaggtgcaaaaagaggacatatccgtggtgttcagcacagcttcctgggaaggtcgtgctgacttttctcaagctgacgtgcacaggcagatcgccattgtgttcaaaacgccaccatacgaggacctggagatctcagagcccgtgacggtcaacgtgttcttgcagcggctcacagacggggtctgcagcgagccgctgcccttcacgtacttgcctcgggaccatgacagctatggtgtggacaagaagcgaaagcggggactgcctgatgtccttggagagctgagcagctctgatccacatggaattgaaagcaagcgacggaaaaagaaaccagtgttcttggaccacttcctgcctggccacagctccggcttgttcctgccgccatcggctctgcagtcagcagacactgatttcttccctggtaccatatcccttcctgggttggagcctcctggcggccctgacctcctggatgatggctttgcctacgatccctctgccccaacgctcttcactatgttggacctgctgcccccagcaccaccacttgccagtgctgtggtgggtaatgggggtgcaggggccacggtcgtggagtctcctggcccagagcccctgtcgctggactcttttgcagctccgggccctggggatgttggtactgctagccttgtgggcagcaacatgttccctaaccagtaccgagaggcagccttcgggggtggcctcctgtccccagggcctgaagccacgtagcctctgagttgaccaggaggcagtgggtgaggcttgtggtccagcactccatccccgaagccaaccttgatcagtcttccagcttcctcatcctgagtcggacgtctgcagtgctgttgagatggggtgagcgcctgttctctttgagcccattaaacagaatgcggagtccggagaggaaaaggggctcctgcaggtggaccccttctcaggacagaatctcaagattgtacataggggatagggagcagatccccagtcttcttccccaatcctgaagaagggggtaggttgtttgttcagttttcccaataaaaattagttttttga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]