ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-22 10:52:14, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001415156 1165 bp mRNA linear ROD 12-NOV-2024 DEFINITION Rattus norvegicus paired related homeobox 2 (Prrx2), mRNA. ACCESSION NM_001415156 XM_039104087 VERSION NM_001415156.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1165) AUTHORS Cao,J., Wu,M., Mo,W., Zhao,M., Gu,L., Wang,X., Zhang,B. and Cao,J. TITLE Upregulation of PRRX2 by silencing Marveld3 as a protective mechanism against radiation-induced ferroptosis in skin cells JOURNAL Mol Med 30 (1), 182 (2024) PUBMED 39434056 REMARK GeneRIF: Upregulation of PRRX2 by silencing Marveld3 as a protective mechanism against radiation-induced ferroptosis in skin cells. Publication Status: Online-Only REFERENCE 2 (bases 1 to 1165) AUTHORS Higuchi,M., Kato,T., Yoshida,S., Ueharu,H., Nishimura,N. and Kato,Y. TITLE PRRX1- and PRRX2-positive mesenchymal stem/progenitor cells are involved in vasculogenesis during rat embryonic pituitary development JOURNAL Cell Tissue Res 361 (2), 557-565 (2015) PUBMED 25795141 REMARK GeneRIF: PRRX1- and PRRX2-positive mesenchymal stem/progenitor cells are present at the periphery of the embryonic pituitary and participate in pituitary vasculogenesis by differentiation into vascular endothelial cells and pericytes. REFERENCE 3 (bases 1 to 1165) AUTHORS Ueharu,H., Higuchi,M., Nishimura,N., Yoshida,S., Shibuya,S., Sensui,K., Kato,T. and Kato,Y. TITLE Expression of Kruppel-like factor 6, KLF6, in rat pituitary stem/progenitor cells and its regulation of the PRRX2 gene JOURNAL J Reprod Dev 60 (4), 304-311 (2014) PUBMED 24881871 REMARK GeneRIF: expression stimulated by Klf6 REFERENCE 4 (bases 1 to 1165) AUTHORS Higuchi,M., Kato,T., Chen,M., Yako,H., Yoshida,S., Kanno,N. and Kato,Y. TITLE Temporospatial gene expression of Prx1 and Prx2 is involved in morphogenesis of cranial placode-derived tissues through epithelio-mesenchymal interaction during rat embryogenesis JOURNAL Cell Tissue Res 353 (1), 27-40 (2013) PUBMED 23644741 REMARK GeneRIF: PRX proteins, especially PRX2, play a role in the morphogenesis of the primordial tissues formed by the epithelio-mesenchymal interaction and that neural crest cells contribute to the morphogenesis of tissues derived from the cranial placode. REFERENCE 5 (bases 1 to 1165) AUTHORS Susa,T., Kato,T., Yoshida,S., Yako,H., Higuchi,M. and Kato,Y. TITLE Paired-related homeodomain proteins Prx1 and Prx2 are expressed in embryonic pituitary stem/progenitor cells and may be involved in the early stage of pituitary differentiation JOURNAL J Neuroendocrinol 24 (9), 1201-1212 (2012) PUBMED 22577874 REMARK GeneRIF: data indicate that PRXs are produced in the pituitary progenitor cells and may play roles in the process of terminal differentiation during early pituitary organogenesis. REFERENCE 6 (bases 1 to 1165) AUTHORS ten Berge,D., Brouwer,A., Korving,J., Reijnen,M.J., van Raaij,E.J., Verbeek,F., Gaffield,W. and Meijlink,F. TITLE Prx1 and Prx2 are upstream regulators of sonic hedgehog and control cell proliferation during mandibular arch morphogenesis JOURNAL Development 128 (15), 2929-2938 (2001) PUBMED 11532916 REFERENCE 7 (bases 1 to 1165) AUTHORS Bergwerff,M., Gittenberger-de Groot,A.C., Wisse,L.J., DeRuiter,M.C., Wessels,A., Martin,J.F., Olson,E.N. and Kern,M.J. TITLE Loss of function of the Prx1 and Prx2 homeobox genes alters architecture of the great elastic arteries and ductus arteriosus JOURNAL Virchows Arch 436 (1), 12-19 (2000) PUBMED 10664157 REFERENCE 8 (bases 1 to 1165) AUTHORS Lu,M.F., Cheng,H.T., Kern,M.J., Potter,S.S., Tran,B., Diekwisch,T.G. and Martin,J.F. TITLE prx-1 functions cooperatively with another paired-related homeobox gene, prx-2, to maintain cell fates within the craniofacial mesenchyme JOURNAL Development 126 (3), 495-504 (1999) PUBMED 9876178 REFERENCE 9 (bases 1 to 1165) AUTHORS Lu,M.F., Cheng,H.T., Lacy,A.R., Kern,M.J., Argao,E.A., Potter,S.S., Olson,E.N. and Martin,J.F. TITLE Paired-related homeobox genes cooperate in handplate and hindlimb zeugopod morphogenesis JOURNAL Dev Biol 205 (1), 145-157 (1999) PUBMED 9882503 REFERENCE 10 (bases 1 to 1165) AUTHORS ten Berge,D., Brouwer,A., Korving,J., Martin,J.F. and Meijlink,F. TITLE Prx1 and Prx2 in skeletogenesis: roles in the craniofacial region, inner ear and limbs JOURNAL Development 125 (19), 3831-3842 (1998) PUBMED 9729491 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAXUCZ010000003.1. On Dec 22, 2022 this sequence version replaced XM_039104087.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR22582419.2469927.1, SRR22582416.30317.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5760383, SAMEA5760389 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-335 JAXUCZ010000003.1 34530331-34530665 336-523 JAXUCZ010000003.1 34563371-34563558 524-702 JAXUCZ010000003.1 34564440-34564618 703-1165 JAXUCZ010000003.1 34565822-34566284 FEATURES Location/Qualifiers source 1..1165 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="3" /map="3p12" gene 1..1165 /gene="Prrx2" /gene_synonym="Prx2" /note="paired related homeobox 2" /db_xref="GeneID:113931" /db_xref="RGD:1311471" exon 1..335 /gene="Prrx2" /gene_synonym="Prx2" /inference="alignment:Splign:2.1.0" misc_feature 32..34 /gene="Prrx2" /gene_synonym="Prx2" /note="upstream in-frame stop codon" CDS 92..838 /gene="Prrx2" /gene_synonym="Prx2" /codon_start=1 /product="paired mesoderm homeobox protein 2" /protein_id="NP_001402085.1" /db_xref="GeneID:113931" /db_xref="RGD:1311471" /translation="
MDSAAAAFALDPPAPGPGPPPAPGDCAQARKNFSVSHLLDLEEVAAAGRRAAGPVPGPEAREGAAREPSGGSSGSEAAPQDGDCPSPGHGSATKRKKKQRRNRTTFNSSQLQALERVFERTHYPDAFVREELARRVNLSEARVQVWFQNRRAKFRRNERAMLATRSASLLKSYGQEAAIEQPVAPRPTTLSPDYLSWPASSPYSSVPPYSPGGSSPATPGVNMANSIASLRLKAKEFSLHHSQVPTVN"
misc_feature 401..559
/gene="Prrx2"
/gene_synonym="Prx2"
/note="Region: Homeodomain; pfam00046"
/db_xref="CDD:459649"
misc_feature <419..733
/gene="Prrx2"
/gene_synonym="Prx2"
/note="Homeodomain-containing transcription factor
[Transcription]; Region: COG5576"
/db_xref="CDD:227863"
misc_feature 755..805
/gene="Prrx2"
/gene_synonym="Prx2"
/note="OAR motif; Region: OAR; pfam03826"
/db_xref="CDD:461067"
exon 336..523
/gene="Prrx2"
/gene_synonym="Prx2"
/inference="alignment:Splign:2.1.0"
exon 524..702
/gene="Prrx2"
/gene_synonym="Prx2"
/inference="alignment:Splign:2.1.0"
exon 703..1165
/gene="Prrx2"
/gene_synonym="Prx2"
/inference="alignment:Splign:2.1.0"
ORIGIN
gcagaaagttcgggtccccgaccgactgacttgagagccggcgcggcgaacagcgggaggcggcggcggccggcagaggcgcgcccggggcatggacagcgcggccgccgccttcgccttggacccgccagcgcccggcccggggcccccgcccgcacccggtgactgcgcccaggcgcgcaagaacttctcggtgagccacctcctggacctggaggaggtggcggctgccgggcgcagggctgcggggccggtgccggggcccgaggcgcgggagggagcggcgcgcgaaccgtccgggggcagcagcggcagcgaggcggcgccgcaggacggtgactgtcccagccccggccatggcagtgccaccaaacggaagaagaagcagcgtcggaatcgaaccacattcaacagcagccagctgcaggcgctggagcgtgtatttgagcgcacacactaccctgacgcctttgtgcgtgaagagctagcccgccgtgtcaacctcagtgaggcacgtgtccaagtctggttccagaaccgccgtgccaagtttcgccggaacgaacgtgccatgctggctacccgctctgcctcgctgctcaagtcttacggccaggaggcagccattgagcagcctgtggccccccgacctaccacactgagcccagattatctatcctggccagcatcgtccccctacagctcggtgcctccctacagccccggaggttcaagtcctgcaactcctggagtcaatatggccaacagcatcgctagccttcgcctcaaggccaaagagttcagcttacaccacagccaggtgcccacagtgaactgacaatgtgcactgggcccagcctccttcctggcccaatggcagaccgcagtaaaggaagtagccttgtccgtccctgtcctcagacaaactgggcagcctctcctgtgcctttttctccatcgcagctctctgagtcccagaggcctgttgggtactggaagcaacagttaaacaggtcactgctatggtggctgagattgtggcctaaggcccctggggtggcctggccagaaggcggagctggagtccgccaaggaactcacttacttatgtattaaaaccaaaaagcttttctctttaaggaataaaaacatttttcttaagctc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]