GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-20 09:59:43, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_001415156            1165 bp    mRNA    linear   ROD 12-NOV-2024
DEFINITION  Rattus norvegicus paired related homeobox 2 (Prrx2), mRNA.
ACCESSION   NM_001415156 XM_039104087
VERSION     NM_001415156.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1165)
  AUTHORS   Cao,J., Wu,M., Mo,W., Zhao,M., Gu,L., Wang,X., Zhang,B. and Cao,J.
  TITLE     Upregulation of PRRX2 by silencing Marveld3 as a protective
            mechanism against radiation-induced ferroptosis in skin cells
  JOURNAL   Mol Med 30 (1), 182 (2024)
   PUBMED   39434056
  REMARK    GeneRIF: Upregulation of PRRX2 by silencing Marveld3 as a
            protective mechanism against radiation-induced ferroptosis in skin
            cells.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1165)
  AUTHORS   Higuchi,M., Kato,T., Yoshida,S., Ueharu,H., Nishimura,N. and
            Kato,Y.
  TITLE     PRRX1- and PRRX2-positive mesenchymal stem/progenitor cells are
            involved in vasculogenesis during rat embryonic pituitary
            development
  JOURNAL   Cell Tissue Res 361 (2), 557-565 (2015)
   PUBMED   25795141
  REMARK    GeneRIF: PRRX1- and PRRX2-positive mesenchymal stem/progenitor
            cells are present at the periphery of the embryonic pituitary and
            participate in pituitary vasculogenesis by differentiation into
            vascular endothelial cells and pericytes.
REFERENCE   3  (bases 1 to 1165)
  AUTHORS   Ueharu,H., Higuchi,M., Nishimura,N., Yoshida,S., Shibuya,S.,
            Sensui,K., Kato,T. and Kato,Y.
  TITLE     Expression of Kruppel-like factor 6, KLF6, in rat pituitary
            stem/progenitor cells and its regulation of the PRRX2 gene
  JOURNAL   J Reprod Dev 60 (4), 304-311 (2014)
   PUBMED   24881871
  REMARK    GeneRIF: expression stimulated by Klf6
REFERENCE   4  (bases 1 to 1165)
  AUTHORS   Higuchi,M., Kato,T., Chen,M., Yako,H., Yoshida,S., Kanno,N. and
            Kato,Y.
  TITLE     Temporospatial gene expression of Prx1 and Prx2 is involved in
            morphogenesis of cranial placode-derived tissues through
            epithelio-mesenchymal interaction during rat embryogenesis
  JOURNAL   Cell Tissue Res 353 (1), 27-40 (2013)
   PUBMED   23644741
  REMARK    GeneRIF: PRX proteins, especially PRX2, play a role in the
            morphogenesis of the primordial tissues formed by the
            epithelio-mesenchymal interaction and that neural crest cells
            contribute to the morphogenesis of tissues derived from the cranial
            placode.
REFERENCE   5  (bases 1 to 1165)
  AUTHORS   Susa,T., Kato,T., Yoshida,S., Yako,H., Higuchi,M. and Kato,Y.
  TITLE     Paired-related homeodomain proteins Prx1 and Prx2 are expressed in
            embryonic pituitary stem/progenitor cells and may be involved in
            the early stage of pituitary differentiation
  JOURNAL   J Neuroendocrinol 24 (9), 1201-1212 (2012)
   PUBMED   22577874
  REMARK    GeneRIF: data indicate that PRXs are produced in the pituitary
            progenitor cells and may play roles in the process of terminal
            differentiation during early pituitary organogenesis.
REFERENCE   6  (bases 1 to 1165)
  AUTHORS   ten Berge,D., Brouwer,A., Korving,J., Reijnen,M.J., van Raaij,E.J.,
            Verbeek,F., Gaffield,W. and Meijlink,F.
  TITLE     Prx1 and Prx2 are upstream regulators of sonic hedgehog and control
            cell proliferation during mandibular arch morphogenesis
  JOURNAL   Development 128 (15), 2929-2938 (2001)
   PUBMED   11532916
REFERENCE   7  (bases 1 to 1165)
  AUTHORS   Bergwerff,M., Gittenberger-de Groot,A.C., Wisse,L.J.,
            DeRuiter,M.C., Wessels,A., Martin,J.F., Olson,E.N. and Kern,M.J.
  TITLE     Loss of function of the Prx1 and Prx2 homeobox genes alters
            architecture of the great elastic arteries and ductus arteriosus
  JOURNAL   Virchows Arch 436 (1), 12-19 (2000)
   PUBMED   10664157
REFERENCE   8  (bases 1 to 1165)
  AUTHORS   Lu,M.F., Cheng,H.T., Kern,M.J., Potter,S.S., Tran,B.,
            Diekwisch,T.G. and Martin,J.F.
  TITLE     prx-1 functions cooperatively with another paired-related homeobox
            gene, prx-2, to maintain cell fates within the craniofacial
            mesenchyme
  JOURNAL   Development 126 (3), 495-504 (1999)
   PUBMED   9876178
REFERENCE   9  (bases 1 to 1165)
  AUTHORS   Lu,M.F., Cheng,H.T., Lacy,A.R., Kern,M.J., Argao,E.A., Potter,S.S.,
            Olson,E.N. and Martin,J.F.
  TITLE     Paired-related homeobox genes cooperate in handplate and hindlimb
            zeugopod morphogenesis
  JOURNAL   Dev Biol 205 (1), 145-157 (1999)
   PUBMED   9882503
REFERENCE   10 (bases 1 to 1165)
  AUTHORS   ten Berge,D., Brouwer,A., Korving,J., Martin,J.F. and Meijlink,F.
  TITLE     Prx1 and Prx2 in skeletogenesis: roles in the craniofacial region,
            inner ear and limbs
  JOURNAL   Development 125 (19), 3831-3842 (1998)
   PUBMED   9729491
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000003.1.
            
            On Dec 22, 2022 this sequence version replaced XM_039104087.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR22582419.2469927.1,
                                           SRR22582416.30317.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5760383, SAMEA5760389
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-335               JAXUCZ010000003.1  34530331-34530665
            336-523             JAXUCZ010000003.1  34563371-34563558
            524-702             JAXUCZ010000003.1  34564440-34564618
            703-1165            JAXUCZ010000003.1  34565822-34566284
FEATURES             Location/Qualifiers
     source          1..1165
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="3"
                     /map="3p12"
     gene            1..1165
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /note="paired related homeobox 2"
                     /db_xref="GeneID:113931"
                     /db_xref="RGD:1311471"
     exon            1..335
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    32..34
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /note="upstream in-frame stop codon"
     CDS             92..838
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /codon_start=1
                     /product="paired mesoderm homeobox protein 2"
                     /protein_id="NP_001402085.1"
                     /db_xref="GeneID:113931"
                     /db_xref="RGD:1311471"
                     /translation="
MDSAAAAFALDPPAPGPGPPPAPGDCAQARKNFSVSHLLDLEEVAAAGRRAAGPVPGPEAREGAAREPSGGSSGSEAAPQDGDCPSPGHGSATKRKKKQRRNRTTFNSSQLQALERVFERTHYPDAFVREELARRVNLSEARVQVWFQNRRAKFRRNERAMLATRSASLLKSYGQEAAIEQPVAPRPTTLSPDYLSWPASSPYSSVPPYSPGGSSPATPGVNMANSIASLRLKAKEFSLHHSQVPTVN"
     misc_feature    401..559
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    <419..733
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /note="Homeodomain-containing transcription factor
                     [Transcription]; Region: COG5576"
                     /db_xref="CDD:227863"
     misc_feature    755..805
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /note="OAR motif; Region: OAR; pfam03826"
                     /db_xref="CDD:461067"
     exon            336..523
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /inference="alignment:Splign:2.1.0"
     exon            524..702
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /inference="alignment:Splign:2.1.0"
     exon            703..1165
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gcagaaagttcgggtccccgaccgactgacttgagagccggcgcggcgaacagcgggaggcggcggcggccggcagaggcgcgcccggggcatggacagcgcggccgccgccttcgccttggacccgccagcgcccggcccggggcccccgcccgcacccggtgactgcgcccaggcgcgcaagaacttctcggtgagccacctcctggacctggaggaggtggcggctgccgggcgcagggctgcggggccggtgccggggcccgaggcgcgggagggagcggcgcgcgaaccgtccgggggcagcagcggcagcgaggcggcgccgcaggacggtgactgtcccagccccggccatggcagtgccaccaaacggaagaagaagcagcgtcggaatcgaaccacattcaacagcagccagctgcaggcgctggagcgtgtatttgagcgcacacactaccctgacgcctttgtgcgtgaagagctagcccgccgtgtcaacctcagtgaggcacgtgtccaagtctggttccagaaccgccgtgccaagtttcgccggaacgaacgtgccatgctggctacccgctctgcctcgctgctcaagtcttacggccaggaggcagccattgagcagcctgtggccccccgacctaccacactgagcccagattatctatcctggccagcatcgtccccctacagctcggtgcctccctacagccccggaggttcaagtcctgcaactcctggagtcaatatggccaacagcatcgctagccttcgcctcaaggccaaagagttcagcttacaccacagccaggtgcccacagtgaactgacaatgtgcactgggcccagcctccttcctggcccaatggcagaccgcagtaaaggaagtagccttgtccgtccctgtcctcagacaaactgggcagcctctcctgtgcctttttctccatcgcagctctctgagtcccagaggcctgttgggtactggaagcaacagttaaacaggtcactgctatggtggctgagattgtggcctaaggcccctggggtggcctggccagaaggcggagctggagtccgccaaggaactcacttacttatgtattaaaaccaaaaagcttttctctttaaggaataaaaacatttttcttaagctc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]