LOCUS       NM_001277244             666 bp    mRNA    linear   ROD 17-JUL-2023
DEFINITION  Rattus norvegicus ribosomal protein S5 (Rps5), transcript variant
            2, mRNA.
ACCESSION   NM_001277244
VERSION     NM_001277244.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 666)
  AUTHORS   Xu WH, Hu HG, Tian Y, Wang SZ, Li J, Li JZ, Deng X, Qian H, Qiu L,
            Hu ZL, Wu QY, Chai YF, Guo C, Xie WF and Zhang JP.
  TITLE     Bioactive compound reveals a novel function for ribosomal protein
            S5 in hepatic stellate cell activation and hepatic fibrosis
  JOURNAL   Hepatology 60 (2), 648-660 (2014)
   PUBMED   24668691
  REMARK    GeneRIF: These results demonstrate that RPS5 is implicated in
            hepatic fibrogenesis.
REFERENCE   2  (bases 1 to 666)
  AUTHORS   Zanivan S, Maione F, Hein MY, Hernandez-Fernaud JR, Ostasiewicz P,
            Giraudo E and Mann M.
  TITLE     SILAC-based proteomics of human primary endothelial cell
            morphogenesis unveils tumor angiogenic markers
  JOURNAL   Mol Cell Proteomics 12 (12), 3599-3611 (2013)
   PUBMED   23979707
REFERENCE   3  (bases 1 to 666)
  AUTHORS   Anger AM, Armache JP, Berninghausen O, Habeck M, Subklewe M, Wilson
            DN and Beckmann R.
  TITLE     Structures of the human and Drosophila 80S ribosome
  JOURNAL   Nature 497 (7447), 80-85 (2013)
   PUBMED   23636399
REFERENCE   4  (bases 1 to 666)
  AUTHORS   Baltz AG, Munschauer M, Schwanhausser B, Vasile A, Murakawa Y,
            Schueler M, Youngs N, Penfold-Brown D, Drew K, Milek M, Wyler E,
            Bonneau R, Selbach M, Dieterich C and Landthaler M.
  TITLE     The mRNA-bound proteome and its global occupancy profile on
            protein-coding transcripts
  JOURNAL   Mol Cell 46 (5), 674-690 (2012)
   PUBMED   22681889
REFERENCE   5  (bases 1 to 666)
  AUTHORS   Castello A, Fischer B, Eichelbaum K, Horos R, Beckmann BM, Strein
            C, Davey NE, Humphreys DT, Preiss T, Steinmetz LM, Krijgsveld J and
            Hentze MW.
  TITLE     Insights into RNA biology from an atlas of mammalian mRNA-binding
            proteins
  JOURNAL   Cell 149 (6), 1393-1406 (2012)
   PUBMED   22658674
REFERENCE   6  (bases 1 to 666)
  AUTHORS   Vladimirov SN, Ivanov AV, Karpova GG, Musolyamov AK, Egorov TA,
            Thiede B, Wittmann-Liebold B and Otto A.
  TITLE     Characterization of the human small-ribosomal-subunit proteins by
            N-terminal and internal sequencing, and mass spectrometry
  JOURNAL   Eur J Biochem 239 (1), 144-149 (1996)
   PUBMED   8706699
REFERENCE   7  (bases 1 to 666)
  AUTHORS   Kuwano Y, Olvera J and Wool IG.
  TITLE     The primary structure of rat ribosomal protein S5. A ribosomal
            protein present in the rat genome in a single copy
  JOURNAL   J Biol Chem 267 (35), 25304-25308 (1992)
   PUBMED   1460027
REFERENCE   8  (bases 1 to 666)
  AUTHORS   Lutsch,G., Bielka,H., Enzmann,G. and Noll,F.
  TITLE     Electron microscopic investigations on the location of rat liver
            ribosomal proteins S3a, S5, S6, S7 and S9 by means of antibody
            labeling
  JOURNAL   Biomed Biochim Acta 42 (6), 705-723 (1983)
   PUBMED   6196023
REFERENCE   9  (bases 1 to 666)
  AUTHORS   Collatz,E., Ulbrich,N., Tsurugi,K., Lightfoot,H.N., MacKinlay,W.,
            Lin,A. and Wool,I.G.
  TITLE     Isolation of eukaryotic ribosomal proteins. Purification and
            characterization of the 40 S ribosomal subunit proteins Sa, Sc,
            S3a, S3b, S5', S9, S10, S11, S12, S14, S15, S15', S16, S17, S18,
            S19, S20, S21, S26, S27', and S29
  JOURNAL   J Biol Chem 252 (24), 9071-9080 (1977)
   PUBMED   925037
REFERENCE   10 (bases 1 to 666)
  AUTHORS   Collatz,E., Wool,I.G., Lin,A. and Stoffler,G.
  TITLE     The isolation of eukaryotic ribosomal proteins. The purification
            and characterization of the 40 S ribosomal subunit proteins S2, S3,
            S4, S5, S6, S7, S8, S9, S13, S23/S24, S27, and S28
  JOURNAL   J Biol Chem 251 (15), 4666-4672 (1976)
   PUBMED   947902
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000029.1 and FM052146.1.
            
            Transcript Variant: This variant (2) lacks an in-frame exon in the
            coding region, compared to variant 1. The encoded isoform (2) is
            shorter, compared to isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: FQ224177.1, SRR8487230.45349.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5760393, SAMN06621351
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-44                JACYVU010000029.1  1702786-1702829
            45-545              FM052146.1         1-501
            546-574             FM052146.1         601-629
            575-666             JACYVU010000029.1  1706992-1707083
FEATURES             Location/Qualifiers
     source          1..666
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /map="1q21"
     gene            1..666
                     /gene="Rps5"
                     /note="ribosomal protein S5"
                     /db_xref="GeneID:25538"
                     /db_xref="RGD:3601"
     exon            1..97
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            98..206
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     CDS             99..614
                     /gene="Rps5"
                     /note="isoform 2 is encoded by transcript variant 2; 40S
                     ribosomal protein S5; small ribosomal subunit protein uS7"
                     /codon_start=1
                     /product="small ribosomal subunit protein uS7 isoform 2"
                     /protein_id="NP_001264173.1"
                     /db_xref="GeneID:25538"
                     /db_xref="RGD:3601"
                     /translation="

MTEWETATPAVAETPDIKLFGKWSTDDVQINDISLQDYIAVKEKYAKYLPHSAGRYAAKRFRKAQCPIVERLTNSMMMHGRNNGKKLMTVRIVKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQAVDVSPLRRVNQGSSNSYAIKKKDELERVAKSNR"

     misc_feature    150..611
                     /gene="Rps5"
                     /note="Eukaryota homolog of Ribosomal Protein S7; Region:
                     uS7_Eukaryote; cd14867"
                     /db_xref="CDD:271246"
     misc_feature    order(150..152,237..245,249..260,357..359,369..371)
                     /gene="Rps5"
                     /note="S9 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(249..251,255..257,267..278,285..287,309..311,
                     318..320,324..338,348..362,369..371,489..497,501..503,
                     531..533)
                     /gene="Rps5"
                     /note="rRNA binding site [nucleotide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(486..488,495..497,501..503,609..611)
                     /gene="Rps5"
                     /note="S11 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     exon            207..416
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            417..545
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            546..666
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

aaaagcgctggcctgctacgttcggcctcttcctgtctgtgccagaactgcgcgtggtccgcgccgatcgactgagaagcccggtttgcgctctcagaatgactgaatgggaaacagccacacccgcggtggcagagaccccggacatcaagctctttgggaaatggagcactgatgatgtgcagatcaacgatatttctctacaggattacattgctgtgaaggagaagtatgccaagtacctgccccacagtgcaggacggtatgctgccaagcgtttccgcaaagcacagtgtcccatcgtggagcgccttactaactccatgatgatgcacggtcgtaacaacggcaagaagctcatgactgtacgaattgtcaagcatgcctttgagatcatccacctgctcactggtgagaaccctctgcaggtcctggtgaatgctatcatcaacagtggcccccgagaagactcaacacgcattgggcgggctggaacagtgagacggcaggctgtggatgtatccccacttcgccgagtgaatcagggctcctccaactcctatgctatcaagaagaaagatgaactggagcgtgtggccaagtctaaccgctgatttcccagctgctgcctaataaattgtgtgccctttgggacagttacatctt

//