GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-05 10:10:05, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001271453            1831 bp    mRNA    linear   ROD 20-MAR-2023
DEFINITION  Rattus norvegicus gastrulation brain homeobox 1 (Gbx1), mRNA.
ACCESSION   NM_001271453 XM_001063850
VERSION     NM_001271453.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1831)
  AUTHORS   Meziane H, Fraulob V, Riet F, Krezel W, Selloum M, Geffarth M,
            Acampora D, Herault Y, Simeone A, Brand M, Dolle P and Rhinn M.
  TITLE     The homeodomain factor Gbx1 is required for locomotion and cell
            specification in the dorsal spinal cord
  JOURNAL   PeerJ 1, e142 (2013)
   PUBMED   24010020
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1831)
  AUTHORS   Buckley DM, Burroughs-Garcia J, Lewandoski M and Waters ST.
  TITLE     Characterization of the Gbx1-/- mouse mutant: a requirement for
            Gbx1 in normal locomotion and sensorimotor circuit development
  JOURNAL   PLoS One 8 (2), e56214 (2013)
   PUBMED   23418536
REFERENCE   3  (bases 1 to 1831)
  AUTHORS   Obinata A, Osakabe K, Yamaguchi M, Morimoto R and Akimoto Y.
  TITLE     Tgm2/Gh, Gbx1 and TGF-beta are involved in retinoic acid-induced
            transdifferentiation from epidermis to mucosal epithelium
  JOURNAL   Int J Dev Biol 55 (10-12), 933-943 (2011)
   PUBMED   22252490
  REMARK    GeneRIF: Tgm2/Gh, Gbx1 and TGF-beta are involved in retinoic
            acid-induced transdifferentiation from epidermis to mucosal
            epithelium
REFERENCE   4  (bases 1 to 1831)
  AUTHORS   Rhinn M, Lun K, Werner M, Simeone A and Brand M.
  TITLE     Isolation and expression of the homeobox gene Gbx1 during mouse
            development
  JOURNAL   Dev Dyn 229 (2), 334-339 (2004)
   PUBMED   14745958
REFERENCE   5  (bases 1 to 1831)
  AUTHORS   Asbreuk CH, van Schaick HS, Cox JJ, Kromkamp M, Smidt MP and
            Burbach JP.
  TITLE     The homeobox genes Lhx7 and Gbx1 are expressed in the basal
            forebrain cholinergic system
  JOURNAL   Neuroscience 109 (2), 287-298 (2002)
   PUBMED   11801365
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000141.1.
            
            On Sep 26, 2012 this sequence version replaced XM_001063850.3.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates and exon combination used
            for the transcript record were based on alignment to full-length
            mouse mRNAs AF547996.1 and AY319256.1.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMN09345330,
                              SAMN13663605 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            inferred exon combination :: based on alignments, homology
            RefSeq Select criteria    :: based on single protein-coding
                                         transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1113              JACYVU010000141.1  266178-267290
            1114-1831           JACYVU010000141.1  291990-292707
FEATURES             Location/Qualifiers
     source          1..1831
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="4"
                     /map="4q11"
     gene            1..1831
                     /gene="Gbx1"
                     /note="gastrulation brain homeobox 1"
                     /db_xref="GeneID:246149"
                     /db_xref="RGD:621864"
     exon            1..1113
                     /gene="Gbx1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    375..377
                     /gene="Gbx1"
                     /note="upstream in-frame stop codon"
     CDS             387..1664
                     /gene="Gbx1"
                     /note="gastrulation brain homeo box 1"
                     /codon_start=1
                     /product="homeobox protein GBX-1"
                     /protein_id="NP_001258382.1"
                     /db_xref="GeneID:246149"
                     /db_xref="RGD:621864"
                     /translation="
MSPEGDTPSPPARPLPPYERGSAAPEPHCAEPAPRRYLGPRARSEPCVSAPGARRGPGSAMQRAAGGGAPGGSGGSGGGPGTAFSIDSLIGPPPPRSGHLLYTGYPMFMPYRPLVLPQALAPAPLPAGLPPLAPLASFAGRLSNTFCAGLGQAVPSMVALTTALPSFAEPPDAYYGPPELAAAAAAAAASTVSRSNPEPPARRTDGALDADELLPAREKVTEPPPPPPPPPPHFSETFPSLPAEGKVYSSDEEKLEPPAGEPAGSEPEEEGSGGDSEDSFLDSSAGGPGALLGPKPKLKGSLGTGAEEGTPVATGVTTPGGKSRRRRTAFTSEQLLELEKEFHCKKYLSLTERSQIAHALKLSEVQVKIWFQNRRAKWKRIKAGNVSSRSGEPVRNPKIVVPIPVHVNRFAVRSQHQQMEQGARP"
     misc_feature    order(1356..1370,1374..1376,1425..1427,1443..1445,
                     1482..1484,1488..1493,1500..1505,1509..1517,1521..1526)
                     /gene="Gbx1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    1362..1523
                     /gene="Gbx1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(1362..1364,1371..1373,1491..1493,1500..1505,
                     1512..1514)
                     /gene="Gbx1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            1114..1831
                     /gene="Gbx1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gcgccgcgtcctgactcctacggatcgccactccgtgcgccctgagtcgctcctggcgtcccacgcgcccccgccccgccccgccgcgcccctctcgcccttcgagccgcgccgagcccgggtcctgtgggctgagccgggagcaggtccgggcgcggggaggggacctggccagctgccgccgccgcctcctcgcccgccgcaaactttcacaaagcggcgggtccggcctcatcaatctgcattaataatagttggttgggccgcggggggcgggcggggtcccgggccggccgggccactgggaaggcgcggggcgcggggcgcgggagccgggcgcggcggcgggcggagggagcaagtgaagcgtaatttgaggaagatggatgagtccggagggcgacacccccagcccgcccgcccgccccctccctccttatgagcgagggagcgcggcgccggagccacactgcgccgagcccgcgccccgccgctacctcggcccgcgcgcccgcagcgagccctgcgtgtccgcgccgggcgcacggcggggcccgggcagcgccatgcagagagcggcgggcggcggcgcccccgggggcagcggcgggagcggcggcggccccggcaccgccttctccatcgactcgctcatcgggccgccgccgccgcgctcgggccacctgctctacactggctaccccatgttcatgccctaccggccgctcgtgctgccgcaggcgctggccccggcgccgctgcccgccggcctgccgccgctggccccgctcgcctcgttcgcgggccgcctgagcaacaccttctgcgcggggctgggccaggcggtgccctcgatggtggcgctgaccactgcactgcccagcttcgcagagccccccgacgcctactacggacccccggagctcgccgccgccgccgccgccgccgccgcctccaccgtctcgcgaagcaacccggagcccccggcccggcgcacagacggagcgctggatgcggacgagctgctgcctgcgcgcgagaaagtgactgagcctccgccgcccccgccgcccccgcctccgcacttctcagagactttcccgagtctgccggcagaggggaaggtgtacagctcagatgaggagaagctggagcccccagcaggagagccagcaggcagcgagccggaggaagaaggctcaggcggtgacagcgaggacagcttcctggacagttctgcagggggcccaggggctcttctgggacctaaaccgaagctaaagggaagcctggggactggcgcagaggaggggacaccagtggccacaggggtcaccacgcctggggggaaaagccgaaggcggcgcacagccttcactagcgagcagcttttggagctggagaaggagtttcactgcaagaaatacctgagtctgaccgagcgctcccagatcgcccacgccctcaagctcagcgaggtgcaggtgaagatctggtttcagaaccgccgggccaagtggaagcgaatcaaggctggcaatgtgagcagccgttctggggagcccgtgagaaaccccaagatcgtagtgcccatacctgtgcacgtcaacaggtttgctgtgcgcagccagcaccaacagatggagcagggggcccggccatgaccaagctcccggggaccgaagtcaacggatctgaacctgtgcctgcccaagactcactgggtgctgcagcctagaggggcctggtggactctgttctgggaaagaccagcgtgttcccaggactgcggcatgagtattcggccagagactgttctcgagacctcagg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]