ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-26 20:18:51, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001271274 1857 bp mRNA linear ROD 27-APR-2025 DEFINITION Rattus norvegicus motor neuron and pancreas homeobox 1 (Mnx1), mRNA. ACCESSION NM_001271274 XM_001059733 XM_003749670 VERSION NM_001271274.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1857) AUTHORS Desai,S.S., Modali,S.D., Parekh,V.I., Kebebew,E. and Agarwal,S.K. TITLE GSK-3beta protein phosphorylates and stabilizes HLXB9 protein in insulinoma cells to form a targetable mechanism of controlling insulinoma cell proliferation JOURNAL J Biol Chem 289 (9), 5386-5398 (2014) PUBMED 24425879 REMARK GeneRIF: Both pHLXB9 and active GSK-3beta are elevated in beta cells with menin knockdown, in MEN1-associated beta cell tumors (insulinomas) REFERENCE 2 (bases 1 to 1857) AUTHORS Kelly,C.E., Thymiakou,E., Dixon,J.E., Tanaka,S., Godwin,J. and Episkopou,V. TITLE Rnf165/Ark2C enhances BMP-Smad signaling to mediate motor axon extension JOURNAL PLoS Biol 11 (4), e1001538 (2013) PUBMED 23610558 REFERENCE 3 (bases 1 to 1857) AUTHORS Cho,A., Ko,H.W. and Eggenschwiler,J.T. TITLE FKBP8 cell-autonomously controls neural tube patterning through a Gli2- and Kif3a-dependent mechanism JOURNAL Dev Biol 321 (1), 27-39 (2008) PUBMED 18590716 REFERENCE 4 (bases 1 to 1857) AUTHORS Lee,S., Lee,B., Joshi,K., Pfaff,S.L., Lee,J.W. and Lee,S.K. TITLE A regulatory network to segregate the identity of neuronal subtypes JOURNAL Dev Cell 14 (6), 877-889 (2008) PUBMED 18539116 REFERENCE 5 (bases 1 to 1857) AUTHORS Winseck,A.K. and Oppenheim,R.W. TITLE An in vivo analysis of Schwann cell programmed cell death in embryonic mice: the role of axons, glial growth factor, and the pro-apoptotic gene Bax JOURNAL Eur J Neurosci 24 (8), 2105-2117 (2006) PUBMED 17042795 REFERENCE 6 (bases 1 to 1857) AUTHORS Yang,X., Arber,S., William,C., Li,L., Tanabe,Y., Jessell,T.M., Birchmeier,C. and Burden,S.J. TITLE Patterning of muscle acetylcholine receptor gene expression in the absence of motor innervation JOURNAL Neuron 30 (2), 399-410 (2001) PUBMED 11395002 REFERENCE 7 (bases 1 to 1857) AUTHORS Li,H., Arber,S., Jessell,T.M. and Edlund,H. TITLE Selective agenesis of the dorsal pancreas in mice lacking homeobox gene Hlxb9 JOURNAL Nat Genet 23 (1), 67-70 (1999) PUBMED 10471501 REFERENCE 8 (bases 1 to 1857) AUTHORS Arber,S., Han,B., Mendelsohn,M., Smith,M., Jessell,T.M. and Sockanathan,S. TITLE Requirement for the homeobox gene Hb9 in the consolidation of motor neuron identity JOURNAL Neuron 23 (4), 659-674 (1999) PUBMED 10482234 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from CH474057.1. On or before Sep 13, 2012 this sequence version replaced XM_001059733.1, XM_003749670.1. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMEA5760434, SAMN12840114 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1857 /organism="Rattus norvegicus" /mol_type="mRNA" /db_xref="taxon:10116" /chromosome="4" /map="4q11" gene 1..1857 /gene="Mnx1" /gene_synonym="Hlxb9" /note="motor neuron and pancreas homeobox 1" /db_xref="GeneID:682076" /db_xref="RGD:1588091" exon 1..728 /gene="Mnx1" /gene_synonym="Hlxb9" /inference="alignment:Splign:2.1.0" misc_feature 14..16 /gene="Mnx1" /gene_synonym="Hlxb9" /note="upstream in-frame stop codon" CDS 38..1249 /gene="Mnx1" /gene_synonym="Hlxb9" /note="homeobox gene HB9; motor neuron and pancreas homeobox protein 1; homeobox protein HB9" /codon_start=1 /product="motor neuron and pancreas homeobox 1" /protein_id="NP_001258203.1" /db_xref="GeneID:682076" /db_xref="RGD:1588091" /translation="
MEKSKNFRIDALLAVDPPRAASTQSAPLALVTSLAATPSGPGRGGSGGGGTSSGASRSCSPASSEATAAPGDRLRAESPSPPRLLTAHCALLPKPGFLGAGGGGGAAGGPGTPHHHAHPGAAAAAAAAAAAAAAGGLALGLHPGGAQGGAGLPAQAALYGHPVYSYSAAAAAAALAGQHPALSYSYPQVQGAHPAHPADPIKLGAGTFQLDQWLRASTAGMILPKMPDFSSQAQSNLLGKCRRPRTAFTSQQLLELEHQFKLNKYLSRPKRFEVATSLMLTETQVKIWFQNRRMKWKRSKKAKEQAAQEAEKQKGSGGGAGKGGTEEKTEEELLGPPVSGDKASGRRLRDLRDSDPDEDEDDEEDHFPYSNGVGAHAASSDCSSEDDSPPPRPGGPGHQPLPQ"
misc_feature 38..40
/gene="Mnx1"
/gene_synonym="Hlxb9"
/note="N-acetylmethionine.
/evidence=ECO:0000250|UniProtKB:P50219; propagated from
UniProtKB/Swiss-Prot (M0R6D8.2); acetylation site"
misc_feature 131..280
/gene="Mnx1"
/gene_synonym="Hlxb9"
/note="propagated from UniProtKB/Swiss-Prot (M0R6D8.2);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 269..271
/gene="Mnx1"
/gene_synonym="Hlxb9"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:P50219; propagated from
UniProtKB/Swiss-Prot (M0R6D8.2); phosphorylation site"
misc_feature 275..277
/gene="Mnx1"
/gene_synonym="Hlxb9"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:P50219; propagated from
UniProtKB/Swiss-Prot (M0R6D8.2); phosphorylation site"
misc_feature 761..931
/gene="Mnx1"
/gene_synonym="Hlxb9"
/note="Region: Homeodomain; pfam00046"
/db_xref="CDD:459649"
misc_feature 932..1246
/gene="Mnx1"
/gene_synonym="Hlxb9"
/note="propagated from UniProtKB/Swiss-Prot (M0R6D8.2);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
exon 729..889
/gene="Mnx1"
/gene_synonym="Hlxb9"
/inference="alignment:Splign:2.1.0"
exon 890..1857
/gene="Mnx1"
/gene_synonym="Hlxb9"
/inference="alignment:Splign:2.1.0"
ORIGIN
cacccttgggccctgatcgtcagctccaaacgagccgatggaaaaatccaaaaatttccgcatcgacgccttgctggcggtggatcccccgcgagccgcctccacgcagagcgcgcctctggccttggtcacttccctcgccgctacaccatctggtcccggccgcggcggtagcggtggcgggggaaccagtagcggggcgagccgcagctgcagtcccgcgtcctcggaggccaccgcagcacccggtgatagactgagggctgagagcccgtcgcctccgcgcttgctgactgcacactgcgcgctgctgcccaagcctggatttctaggcgccgggggaggcggcggcgcggcgggtgggccgggcactccacaccaccacgcgcaccctggtgccgccgccgccgccgctgctgccgcggctgccgccgcagccgggggcctggcactggggctgcaccccgggggcgcacagggcggcgcgggcctcccggcacaggcagctctctacggacacccggtctacagttactcggcagcagctgcagcggccgcgctagctggccagcacccggcgctttcctactcgtatcctcaggtgcagggcgcgcaccctgctcaccctgccgaccccatcaagctgggtgccggcacctttcaactggaccagtggctgcgcgcgtctactgcgggcatgatcctgcccaagatgccggacttcagctcccaggcgcaatcgaacctcttggggaagtgccgaaggcctcgcacggccttcaccagccagcagctgttggagctggaacaccagttcaagctcaacaagtacctgtcgcgacccaagcgttttgaggtggctacctcgctcatgctcaccgagacccaggtgaagatttggttccagaaccgccgaatgaaatggaaacgcagcaaaaaggccaaagagcaggctgcgcaggaggcagagaagcagaagggcagcggcgggggcgccggcaaaggcggcactgaggagaagacggaggaggagctgctgggacctccagtttcgggggacaaggccagcggccgtcgcctgcgggacttgcgggacagtgacccagatgaggatgaggatgatgaagaagaccacttcccctacagcaatggggtcggtgcccacgctgcctcatccgattgctcatctgaggacgactcgcctcccccaaggccaggagggcccgggcaccaacctctgccccagtagttgtcccaaaggcggcagcaggaatgtgcaaaatggcgacctgggacctgggctgcgggggttcaaacttcatccagtggcctgcagccaggctgacagcctctccccggactatgtatgcatccaggtgtgggctggagtgcgaatactttttggaccctcgaaggacagcaagagagaatgaaagaggggctccaatgtgaactttcgttcttttacatttaatttcgggtcatgttggccagaggtgtttgtgagaagaatctaccctttctaggagtggctcctgcctgactcttctctcatcaaagaaaggggaaaaaatgacagtgttaagtgacctagaaacttgaacccgccattggagacaaccattctgttgagaattgaaaacacaggttgaataaaggtgttatgcctatgtatgggatagggtgggatggggtggggtgttatggcatgagcattcagattgctgcaaaatctcagaatggtagtgtatttttgtatattgtatttatatataaagaaagaaacgtctacttatgcatgctaaattattatttagctttcccgttccccaggatagagatgaaatgtaaaataaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]