LOCUS       NM_001192014             738 bp    mRNA    linear   ROD 21-MAR-2023
DEFINITION  Rattus norvegicus notochord homeobox (Noto), mRNA.
ACCESSION   NM_001192014 XM_578357
VERSION     NM_001192014.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 738)
  AUTHORS   Alten L, Schuster-Gossler K, Beckers A, Groos S, Ulmer B, Hegermann
            J, Ochs M and Gossler A.
  TITLE     Differential regulation of node formation, nodal ciliogenesis and
            cilia positioning by Noto and Foxj1
  JOURNAL   Development 139 (7), 1276-1284 (2012)
   PUBMED   22357932
REFERENCE   2  (bases 1 to 738)
  AUTHORS   Vidigal JA, Morkel M, Wittler L, Brouwer-Lehmitz A, Grote P, Macura
            K and Herrmann BG.
  TITLE     An inducible RNA interference system for the functional dissection
            of mouse embryogenesis
  JOURNAL   Nucleic Acids Res 38 (11), e122 (2010)
   PUBMED   20350929
REFERENCE   3  (bases 1 to 738)
  AUTHORS   Zizic Mitrecic M, Mitrecic D, Pochet R, Kostovic-Knezevic L and
            Gajovic S.
  TITLE     The mouse gene Noto is expressed in the tail bud and essential for
            its morphogenesis
  JOURNAL   Cells Tissues Organs 192 (2), 85-92 (2010)
   PUBMED   20197654
REFERENCE   4  (bases 1 to 738)
  AUTHORS   Beckers A, Alten L, Viebahn C, Andre P and Gossler A.
  TITLE     The mouse homeobox gene Noto regulates node morphogenesis,
            notochordal ciliogenesis, and left right patterning
  JOURNAL   Proc Natl Acad Sci U S A 104 (40), 15765-15770 (2007)
   PUBMED   17884984
  REMARK    Erratum:[Proc Natl Acad Sci U S A. 2007 Oct 30;104(44):17554]
REFERENCE   5  (bases 1 to 738)
  AUTHORS   Abdelkhalek HB, Beckers A, Schuster-Gossler K, Pavlova MN,
            Burkhardt H, Lickert H, Rossant J, Reinhardt R, Schalkwyk LC,
            Muller I, Herrmann BG, Ceolin M, Rivera-Pomar R and Gossler A.
  TITLE     The mouse homeobox gene Not is required for caudal notochord
            development and affected by the truncate mutation
  JOURNAL   Genes Dev 18 (14), 1725-1736 (2004)
   PUBMED   15231714
REFERENCE   6  (bases 1 to 738)
  AUTHORS   Mitrecic D, Kostovic-Knezevic L and Gajovic S.
  TITLE     Morphological features of tail bud development in truncate mouse
            mutants
  JOURNAL   Cells Tissues Organs 178 (1), 23-32 (2004)
   PUBMED   15550757
REFERENCE   7  (bases 1 to 738)
  AUTHORS   Dietrich S, Schubert FR and Gruss P.
  TITLE     Altered Pax gene expression in murine notochord mutants: the
            notochord is required to initiate and maintain ventral identity in
            the somite
  JOURNAL   Mech Dev 44 (2-3), 189-207 (1993)
   PUBMED   8155581
REFERENCE   8  (bases 1 to 738)
  AUTHORS   THEILER,K.
  TITLE     Anatomy and development of the 'truncate' (boneless) mutation in
            the mouse
  JOURNAL   Am J Anat 104, 319-343 (1959)
   PUBMED   13837681
COMMENT     INFERRED REFSEQ: This record is predicted by genome sequence
            analysis and is not yet supported by experimental evidence. The
            reference sequence was derived from JACYVU010000148.1.
            
            On Jul 17, 2010 this sequence version replaced XM_578357.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMEA5760434
                              [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-379               JACYVU010000148.1  15291165-15291543
            380-591             JACYVU010000148.1  15292524-15292735
            592-738             JACYVU010000148.1  15295258-15295404
FEATURES             Location/Qualifiers
     source          1..738
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="4"
                     /map="4q34"
     gene            1..738
                     /gene="Noto"
                     /gene_synonym="RGD1562910"
                     /note="notochord homeobox"
                     /db_xref="GeneID:502857"
                     /db_xref="RGD:1562910"
     CDS             1..738
                     /gene="Noto"
                     /gene_synonym="RGD1562910"
                     /note="notochord homolog"
                     /codon_start=1
                     /product="homeobox protein notochord"
                     /protein_id="NP_001178943.1"
                     /db_xref="GeneID:502857"
                     /db_xref="RGD:1562910"
                     /translation="

MSSPVPQPASSGTQVQPGDLGPCPVAVSPVVPNHLARGRLESSFSVEAILARPETREHSATSLPLSTCTSLNFGSVSQYQVLPWVCSTGTWLPTYLSVGIYPMCSMSCMPGLNVTHLFCQQGLRLTGSELPSCLGPLKRAPTVNLQDHNTERHQKRVRTMFSEQQLGELEKVFAKQHNLVGKERAQLAARLHLTENQVRIWFQNRRVKYQKQQKLKSPPPDAMEEPSNSSEGNVRNEDAEAGVGS"

     misc_feature    order(463..477,481..483,532..534,550..552,589..591,
                     595..600,607..612,616..624,628..633)
                     /gene="Noto"
                     /gene_synonym="RGD1562910"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(469..471,478..480,598..600,607..612,619..621)
                     /gene="Noto"
                     /gene_synonym="RGD1562910"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    472..627
                     /gene="Noto"
                     /gene_synonym="RGD1562910"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     exon            1..379
                     /gene="Noto"
                     /gene_synonym="RGD1562910"
                     /inference="alignment:Splign:2.1.0"
     exon            380..591
                     /gene="Noto"
                     /gene_synonym="RGD1562910"
                     /inference="alignment:Splign:2.1.0"
     exon            592..738
                     /gene="Noto"
                     /gene_synonym="RGD1562910"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atgtccagcccagtgccccagcctgcttcctcaggcactcaggtccagcccggggacttgggaccctgtccggtggctgtttccccagtagtcccgaaccacctagctcggggacgcctggagtcctccttctctgttgaggccatcctggcgagacccgagactcgtgagcactctgccacgtctctgccgctctctacctgcaccagtctgaactttggctctgtgtcacagtaccaggtcctgccctgggtgtgctccacggggacttggctgcccacctacctgagcgtaggcatctacccgatgtgctccatgtcctgcatgcccggattgaatgtgactcacctcttctgccaacagggcctcagactcacagggtcagagctaccttcctgtctaggccctctgaaacgggcacccactgtgaaccttcaggaccacaataccgagagacaccaaaagagggttcgcacaatgtttagcgagcagcagctgggagagttggagaaggtatttgcaaagcagcacaacctggtggggaaggagagagcccagttggctgccaggctgcacttgacagagaaccaggtaaggatctggttccagaatcgcagggtaaagtatcaaaagcagcaaaaactgaagtcacctccccctgatgccatggaggagccctccaacagctcagagggcaacgtccggaatgaagacgctgaggcaggagttggcagttaa

//