2024-03-29 19:11:07, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001173469 1834 bp mRNA linear ROD 20-MAR-2023 DEFINITION Rattus norvegicus homeo box D9 (Hoxd9), mRNA. ACCESSION NM_001173469 XM_002726192 VERSION NM_001173469.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1834) AUTHORS Hong Q, Li XD, Xie P and Du SX. TITLE All-trans-retinoic acid suppresses rat embryo hindlimb bud mesenchymal chondrogenesis by modulating HoxD9 expression JOURNAL Bioengineered 12 (1), 3900-3911 (2021) PUBMED 34288810 REMARK GeneRIF: All-trans-retinoic acid suppresses rat embryo hindlimb bud mesenchymal chondrogenesis by modulating HoxD9 expression. REFERENCE 2 (bases 1 to 1834) AUTHORS Raines AM, Adam M, Magella B, Meyer SE, Grimes HL, Dey SK and Potter SS. TITLE Recombineering-based dissection of flanking and paralogous Hox gene functions in mouse reproductive tracts JOURNAL Development 140 (14), 2942-2952 (2013) PUBMED 23760953 REFERENCE 3 (bases 1 to 1834) AUTHORS McIntyre DC, Rakshit S, Yallowitz AR, Loken L, Jeannotte L, Capecchi MR and Wellik DM. TITLE Hox patterning of the vertebrate rib cage JOURNAL Development 134 (16), 2981-2989 (2007) PUBMED 17626057 REFERENCE 4 (bases 1 to 1834) AUTHORS de la Cruz CC, Der-Avakian A, Spyropoulos DD, Tieu DD and Carpenter EM. TITLE Targeted disruption of Hoxd9 and Hoxd10 alters locomotor behavior, vertebral identity, and peripheral nervous system development JOURNAL Dev Biol 216 (2), 595-610 (1999) PUBMED 10642795 REFERENCE 5 (bases 1 to 1834) AUTHORS Chen F and Capecchi MR. TITLE Paralogous mouse Hox genes, Hoxa9, Hoxb9, and Hoxd9, function together to control development of the mammary gland in response to pregnancy JOURNAL Proc Natl Acad Sci U S A 96 (2), 541-546 (1999) PUBMED 9892669 REFERENCE 6 (bases 1 to 1834) AUTHORS Fromental-Ramain C, Warot X, Lakkaraju S, Favier B, Haack H, Birling C, Dierich A, Doll e P and Chambon P. TITLE Specific and redundant functions of the paralogous Hoxa-9 and Hoxd-9 genes in forelimb and axial skeleton patterning JOURNAL Development 122 (2), 461-472 (1996) PUBMED 8625797 REFERENCE 7 (bases 1 to 1834) AUTHORS Zappavigna V, Renucci A, Izpisua-Belmonte JC, Urier G, Peschle C and Duboule D. TITLE HOX4 genes encode transcription factors with potential auto- and cross-regulatory capacities JOURNAL EMBO J 10 (13), 4177-4187 (1991) PUBMED 1756725 REFERENCE 8 (bases 1 to 1834) AUTHORS Oliver G, Sidell N, Fiske W, Heinzmann C, Mohandas T, Sparkes RS and De Robertis EM. TITLE Complementary homeo protein gradients in developing limb buds JOURNAL Genes Dev 3 (5), 641-650 (1989) PUBMED 2568311 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JACYVU010000115.1. On Nov 27, 2020 this sequence version replaced NM_001173469.1. ##Evidence-Data-START## Transcript exon combination :: BC169092.1, FM043112.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5756307, SAMEA5760383 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-859 JACYVU010000115.1 53057396-53058254 860-1834 JACYVU010000115.1 53058602-53059576 FEATURES Location/Qualifiers source 1..1834 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="3" /map="3q23" gene 1..1834 /gene="Hoxd9" /note="homeo box D9" /db_xref="GeneID:688999" /db_xref="RGD:1582908" exon 1..859 /gene="Hoxd9" /inference="alignment:Splign:2.1.0" CDS 70..1101 /gene="Hoxd9" /note="homeobox Hox-D9" /codon_start=1 /product="homeobox protein Hox-D9" /protein_id="NP_001166940.1" /db_xref="GeneID:688999" /db_xref="RGD:1582908" /translation="
MSSSGTLSNYYVDSLIGHEGDEVFAARFGPPGPGTQGRPAGVADGPAAAAEFASCSFAPKSSVFSASWSAVAAQPPAAATMSGLYHPYVSPPPLAAAEPGRYVRSWMEPLPGFPGGAGGGGGSGGGGGGGSGGPGPVPSPGGPANGRHYGIKPETGAAPAPSAASTSSSTSSSSSSKRTECSAARESQGSGGPEFPCNSFLRDKAAAAAAAAAGNGPGVGIGTGPGTGGSSEPSACSDHPSPGCPLKEEEKQPPQPPQQQLDPNNPAANWIHARSTRKKRCPYTKYQTLELEKEFLFNMYLTRDRRYEVARILNLTERQVKIWFQNRRMKMKKMSKEKCPKGD"
misc_feature 70..>534 /gene="Hoxd9" /note="Hox9 activation region; Region: Hox9_act; pfam04617" /db_xref="CDD:428038" misc_feature 406..657 /gene="Hoxd9" /note="propagated from UniProtKB/Swiss-Prot (B5DFK3.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 727..870 /gene="Hoxd9" /note="propagated from UniProtKB/Swiss-Prot (B5DFK3.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 895..1053 /gene="Hoxd9" /note="Homeodomain; Region: HOX; smart00389" /db_xref="CDD:197696" misc_feature order(904..906,913..915,1033..1035,1042..1047) /gene="Hoxd9" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" exon 860..1834 /gene="Hoxd9" /inference="alignment:Splign:2.1.0" ORIGIN
cgggcgccggcgaggagccgctcggcggtgggcagtgtaaccttgggtgggagcgcgcggtgcctcaacatgtcgtccagtggcaccctcagcaactactacgtggactcgctcataggccatgagggcgacgaggtgttcgccgcgcgctttgggccaccggggccggggacacagggtcggcccgcaggtgtggccgatggcccggccgccgccgccgagttcgcctcgtgtagttttgcccccaaatcgtccgtgttctccgcctcgtggtccgcggtggccgcccagcccccggcggcggcgacgatgagcggcctgtaccacccgtacgtgtccccgccgcccctggccgccgccgagccgggccgctacgtacgctcctggatggagccgctgcccggcttccccggcggcgcgggcggtggcggtggcagtggtggcggcggtggcggaggtagcggaggcccgggtcccgttcccagccccggcggtccagccaacgggcgccactacgggattaagcctgaaaccggagcagccccggccccctctgcagcctccacttcctcctccacctcctcgtcctcctcctccaaaaggactgagtgctccgcggcccgcgagtcccaggggagcggcggcccagaattcccgtgcaactcgttcctgcgggacaaggcggcagcggcggcggcggcggcggcagggaacgggcccggggtgggaatcgggaccgggcctgggacgggaggctcgtccgagccctcagcttgcagcgatcacccgagcccgggctgcccgctgaaggaggaggagaagcagccgccgcagccgccgcagcagcaacttgacccaaacaaccctgcagcgaactggatccacgctcgctccacccggaaaaagcgctgtccctacaccaaataccagacgctagagctggagaaggaattcctcttcaacatgtacctcacccgggaccggcgctacgaggtggccaggattctgaaccttacagagagacaagtcaaaatctggttccagaaccgtaggatgaaaatgaaaaagatgagcaaggagaaatgtcctaaaggagactgacccagtgcgggtcaggcctgcagcgctcaaaaggcagcgggttttggttttttgttgttgattgttttctttgtgggtgcttgattcagaaactctgcagcgattcggacattcttcttttttttttaggtagaagtgactgtgtggttggtctctgtgagttatttgggggacgctgtatttgctcgcatatgtattggagaatccaagtggctttggagtcttgtcctatctcactccctccctttcccactcccttggttccttaggaaatgctttattttgtgagtgcacgcaggcttgatggagccctatcctgtgtaaatgttcctcatgtttctggaaagtgctgtagtgtagtctcaccccatccagcctcccaaacagggccaactatctaattccgagaatctgaaagaagagaaagactgtggacacacaccccctcccccaaaaaacccagctcagctgcaggaaaacccctatcctcagggagcccgcggactgacttccagagaggcctaccaagaagccctgggccctgggacacgaggttggggtggggttgaggagaggcttagtccttggagcacggggaagctactttctccccaggagggctgggctccctggggcggcctcgggaggtggccctccatattcctgcctgaggaccagttgtaaatgttaccgcttcctacaaataaatgctgatctgaacaaatggagccca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]