2025-02-03 08:21:07, GGRNA.v2 : RefSeq release 227 (Nov, 2024)
LOCUS NM_001170484 1444 bp mRNA linear ROD 23-AUG-2024 DEFINITION Rattus norvegicus RNA binding motif protein 4 (Rbm4), mRNA. ACCESSION NM_001170484 VERSION NM_001170484.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1444) AUTHORS Lin,J.C., Yan,Y.T., Hsieh,W.K., Peng,P.J., Su,C.H. and Tarn,W.Y. TITLE RBM4 promotes pancreas cell differentiation and insulin expression JOURNAL Mol Cell Biol 33 (2), 319-327 (2013) PUBMED 23129807 REFERENCE 2 (bases 1 to 1444) AUTHORS Baltz,A.G., Munschauer,M., Schwanhausser,B., Vasile,A., Murakawa,Y., Schueler,M., Youngs,N., Penfold-Brown,D., Drew,K., Milek,M., Wyler,E., Bonneau,R., Selbach,M., Dieterich,C. and Landthaler,M. TITLE The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts JOURNAL Mol Cell 46 (5), 674-690 (2012) PUBMED 22681889 REFERENCE 3 (bases 1 to 1444) AUTHORS Castello,A., Fischer,B., Eichelbaum,K., Horos,R., Beckmann,B.M., Strein,C., Davey,N.E., Humphreys,D.T., Preiss,T., Steinmetz,L.M., Krijgsveld,J. and Hentze,M.W. TITLE Insights into RNA biology from an atlas of mammalian mRNA-binding proteins JOURNAL Cell 149 (6), 1393-1406 (2012) PUBMED 22658674 REFERENCE 4 (bases 1 to 1444) AUTHORS Lin,J.C. and Tarn,W.Y. TITLE RBM4 down-regulates PTB and antagonizes its activity in muscle cell-specific alternative splicing JOURNAL J Cell Biol 193 (3), 509-520 (2011) PUBMED 21518792 REFERENCE 5 (bases 1 to 1444) AUTHORS Lin,J.C. and Tarn,W.Y. TITLE RNA-binding motif protein 4 translocates to cytoplasmic granules and suppresses translation via argonaute2 during muscle cell differentiation JOURNAL J Biol Chem 284 (50), 34658-34665 (2009) PUBMED 19801630 REFERENCE 6 (bases 1 to 1444) AUTHORS Kar,A., Havlioglu,N., Tarn,W.Y. and Wu,J.Y. TITLE RBM4 interacts with an intronic element and stimulates tau exon 10 inclusion JOURNAL J Biol Chem 281 (34), 24479-24488 (2006) PUBMED 16777844 REFERENCE 7 (bases 1 to 1444) AUTHORS Markus,M.A. and Morris,B.J. TITLE Lark is the splicing factor RBM4 and exhibits unique subnuclear localization properties JOURNAL DNA Cell Biol 25 (8), 457-464 (2006) PUBMED 16907643 REFERENCE 8 (bases 1 to 1444) AUTHORS Lin,J.C. and Tarn,W.Y. TITLE Exon selection in alpha-tropomyosin mRNA is regulated by the antagonistic action of RBM4 and PTB JOURNAL Mol Cell Biol 25 (22), 10111-10121 (2005) PUBMED 16260624 REFERENCE 9 (bases 1 to 1444) AUTHORS Diederichs,S., Baumer,N., Ji,P., Metzelder,S.K., Idos,G.E., Cauvet,T., Wang,W., Moller,M., Pierschalski,S., Gromoll,J., Schrader,M.G., Koeffler,H.P., Berdel,W.E., Serve,H. and Muller-Tidow,C. TITLE Identification of interaction partners and substrates of the cyclin A1-CDK2 complex JOURNAL J Biol Chem 279 (32), 33727-33741 (2004) PUBMED 15159402 REFERENCE 10 (bases 1 to 1444) AUTHORS Lai,M.C., Kuo,H.W., Chang,W.C. and Tarn,W.Y. TITLE A novel splicing regulator shares a nuclear import pathway with SR proteins JOURNAL EMBO J 22 (6), 1359-1369 (2003) PUBMED 12628928 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAXUCZ010000001.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR26643290.4702.1, SRR26643296.3463.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMEA5760383, SAMEA5760386 [ECO:0006172] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-85 JAXUCZ010000001.1 211516823-211516907 c 86-508 JAXUCZ010000001.1 211515412-211515834 c 509-1202 JAXUCZ010000001.1 211510014-211510707 c 1203-1444 JAXUCZ010000001.1 211507845-211508086 c FEATURES Location/Qualifiers source 1..1444 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="1" /map="1q43" gene 1..1444 /gene="Rbm4" /note="RNA binding motif protein 4" /db_xref="GeneID:293663" /db_xref="RGD:1306891" exon 1..85 /gene="Rbm4" /inference="alignment:Splign:2.1.0" misc_feature 28..30 /gene="Rbm4" /note="upstream in-frame stop codon" exon 86..508 /gene="Rbm4" /inference="alignment:Splign:2.1.0" CDS 97..1194 /gene="Rbm4" /codon_start=1 /product="RNA binding motif protein 4" /protein_id="NP_001163955.1" /db_xref="GeneID:293663" /db_xref="RGD:1306891" /translation="
MVKLFIGNLPREATEQEIRSLFEQYGKVLECDIIKNYGFVHIEDKTAAEDAIRNLHHYKLHGVNINVEASKNKSKASTKLHVGNISPTCTNQELRAKFEEYGPVIECDIVKDYAFVHMERAEDAVEAIRGLDNTEFQGKRMHVQLSTSRLRTAPGMGDQSGCYRCGKEGHWSKECPIDRSGRVADLTEQYNEQYGAVRTPYTMSYGDSLYYNNTYGALDAYYKRCRAARSYEAVAAAAASAYNNYAEQTLSQLPQVQNTAMASHLTSTSLDPYNRHLLPPSGAAAAAAAAAAAAAACTAASTPYYGRDRSPLRRATGPVPTVGEGYGYGHDSELSQASAAARNSLYDMARYEREQYADRARYSAF"
misc_feature 100..300 /gene="Rbm4" /note="RNA recognition motif 1 (RRM1) found in vertebrate RNA-binding protein 4 (RBM4); Region: RRM1_RBM4; cd12606" /db_xref="CDD:410018" misc_feature 328..528 /gene="Rbm4" /note="RNA recognition motif 2 (RRM2) found in vertebrate RNA-binding protein 4 (RBM4); Region: RRM2_RBM4; cd12607" /db_xref="CDD:410019" misc_feature <529..>639 /gene="Rbm4" /note="universal minicircle sequence binding protein (UMSBP); Provisional; Region: PTZ00368" /db_xref="CDD:173561" misc_feature 577..624 /gene="Rbm4" /note="zinc finger; Region: ZnF_C2HC; smart00343" /db_xref="CDD:197667" exon 509..1202 /gene="Rbm4" /inference="alignment:Splign:2.1.0" exon 1203..1444 /gene="Rbm4" /inference="alignment:Splign:2.1.0" ORIGIN
gagtcactgctgtggccgccgccattttagcgttttgtcagagccgtctacgctgcgaggaggaggacctgcagatttccatgcggctgtgtggagatggtgaaactgttcatcggaaatctgccccgggaggccacagagcaggagatccgctcactcttcgagcagtacgggaaggtgctggaatgtgacatcattaagaactatggctttgtgcacatagaggacaagacggccgctgaggatgccatacgcaacctgcaccactacaaactgcacggagtgaacatcaatgtggaagccagcaagaataagagcaaagcttcaaccaaattacatgtgggcaacatcagtcccacttgtaccaaccaagagcttcgggccaagtttgaggagtacggcccagtcatcgaatgtgacatcgtgaaagattatgcctttgtacacatggagcgggcagaagatgcggtggaggccatcaggggccttgacaacacagagtttcaaggcaaacgaatgcacgtgcagttgtccaccagccggcttaggaccgcgcccgggatgggagaccagagcggctgctatcggtgcgggaaagaggggcactggtccaaagagtgtccgatagaccgttcgggccgtgtggcagacttgaccgagcaatataatgagcaatatggagcagtgcgtacgccttacaccatgagttatggggattcattgtattacaacaacacgtacggagcgctcgatgcctactacaagcgctgccgtgctgcccggtcctatgaggcagtggcagctgcagctgcctctgcatataataactatgcagagcagactttgtcccagctgccacaagtccagaacacagccatggccagtcacctcacctccacctctcttgatccctacaatagacatctgttgccgccttcaggagctgctgcagcagcagctgctgctgctgctgctgctgctgcttgtactgcagcttctactccatattacgggcgggatcggagccccctgcgtcgcgctacaggcccagttcccactgttggagagggctacggttacgggcatgacagtgagttgtcccaagcttcagcagctgctcggaattccctgtacgacatggcccggtatgagcgggagcagtatgcggatcgggcgcggtactcagccttttaaagtttgaggtgggatgtgtgtgggctgaaattccgagctgcggttgtgcatgagaatacacccttcgtggtaccccatctccgggacgttctcggctctgtgcattcagtccctcaggaaccatggaccttaatttaccttgttaagttctttctctttcctattctctttcctgctcaatttcctgttctcctgtttattcttctgtaacttcccattcgagttctgttctcccagcatgcctcctatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]