LOCUS       NM_001170484            1444 bp    mRNA    linear   ROD 23-AUG-2024
DEFINITION  Rattus norvegicus RNA binding motif protein 4 (Rbm4), mRNA.
ACCESSION   NM_001170484
VERSION     NM_001170484.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1444)
  AUTHORS   Lin,J.C., Yan,Y.T., Hsieh,W.K., Peng,P.J., Su,C.H. and Tarn,W.Y.
  TITLE     RBM4 promotes pancreas cell differentiation and insulin expression
  JOURNAL   Mol Cell Biol 33 (2), 319-327 (2013)
   PUBMED   23129807
REFERENCE   2  (bases 1 to 1444)
  AUTHORS   Baltz,A.G., Munschauer,M., Schwanhausser,B., Vasile,A.,
            Murakawa,Y., Schueler,M., Youngs,N., Penfold-Brown,D., Drew,K.,
            Milek,M., Wyler,E., Bonneau,R., Selbach,M., Dieterich,C. and
            Landthaler,M.
  TITLE     The mRNA-bound proteome and its global occupancy profile on
            protein-coding transcripts
  JOURNAL   Mol Cell 46 (5), 674-690 (2012)
   PUBMED   22681889
REFERENCE   3  (bases 1 to 1444)
  AUTHORS   Castello,A., Fischer,B., Eichelbaum,K., Horos,R., Beckmann,B.M.,
            Strein,C., Davey,N.E., Humphreys,D.T., Preiss,T., Steinmetz,L.M.,
            Krijgsveld,J. and Hentze,M.W.
  TITLE     Insights into RNA biology from an atlas of mammalian mRNA-binding
            proteins
  JOURNAL   Cell 149 (6), 1393-1406 (2012)
   PUBMED   22658674
REFERENCE   4  (bases 1 to 1444)
  AUTHORS   Lin,J.C. and Tarn,W.Y.
  TITLE     RBM4 down-regulates PTB and antagonizes its activity in muscle
            cell-specific alternative splicing
  JOURNAL   J Cell Biol 193 (3), 509-520 (2011)
   PUBMED   21518792
REFERENCE   5  (bases 1 to 1444)
  AUTHORS   Lin,J.C. and Tarn,W.Y.
  TITLE     RNA-binding motif protein 4 translocates to cytoplasmic granules
            and suppresses translation via argonaute2 during muscle cell
            differentiation
  JOURNAL   J Biol Chem 284 (50), 34658-34665 (2009)
   PUBMED   19801630
REFERENCE   6  (bases 1 to 1444)
  AUTHORS   Kar,A., Havlioglu,N., Tarn,W.Y. and Wu,J.Y.
  TITLE     RBM4 interacts with an intronic element and stimulates tau exon 10
            inclusion
  JOURNAL   J Biol Chem 281 (34), 24479-24488 (2006)
   PUBMED   16777844
REFERENCE   7  (bases 1 to 1444)
  AUTHORS   Markus,M.A. and Morris,B.J.
  TITLE     Lark is the splicing factor RBM4 and exhibits unique subnuclear
            localization properties
  JOURNAL   DNA Cell Biol 25 (8), 457-464 (2006)
   PUBMED   16907643
REFERENCE   8  (bases 1 to 1444)
  AUTHORS   Lin,J.C. and Tarn,W.Y.
  TITLE     Exon selection in alpha-tropomyosin mRNA is regulated by the
            antagonistic action of RBM4 and PTB
  JOURNAL   Mol Cell Biol 25 (22), 10111-10121 (2005)
   PUBMED   16260624
REFERENCE   9  (bases 1 to 1444)
  AUTHORS   Diederichs,S., Baumer,N., Ji,P., Metzelder,S.K., Idos,G.E.,
            Cauvet,T., Wang,W., Moller,M., Pierschalski,S., Gromoll,J.,
            Schrader,M.G., Koeffler,H.P., Berdel,W.E., Serve,H. and
            Muller-Tidow,C.
  TITLE     Identification of interaction partners and substrates of the cyclin
            A1-CDK2 complex
  JOURNAL   J Biol Chem 279 (32), 33727-33741 (2004)
   PUBMED   15159402
REFERENCE   10 (bases 1 to 1444)
  AUTHORS   Lai,M.C., Kuo,H.W., Chang,W.C. and Tarn,W.Y.
  TITLE     A novel splicing regulator shares a nuclear import pathway with SR
            proteins
  JOURNAL   EMBO J 22 (6), 1359-1369 (2003)
   PUBMED   12628928
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000001.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR26643290.4702.1,
                                           SRR26643296.3463.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA5760383,
                                           SAMEA5760386 [ECO:0006172]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-85                JAXUCZ010000001.1  211516823-211516907 c
            86-508              JAXUCZ010000001.1  211515412-211515834 c
            509-1202            JAXUCZ010000001.1  211510014-211510707 c
            1203-1444           JAXUCZ010000001.1  211507845-211508086 c
FEATURES             Location/Qualifiers
     source          1..1444
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /map="1q43"
     gene            1..1444
                     /gene="Rbm4"
                     /note="RNA binding motif protein 4"
                     /db_xref="GeneID:293663"
                     /db_xref="RGD:1306891"
     exon            1..85
                     /gene="Rbm4"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    28..30
                     /gene="Rbm4"
                     /note="upstream in-frame stop codon"
     exon            86..508
                     /gene="Rbm4"
                     /inference="alignment:Splign:2.1.0"
     CDS             97..1194
                     /gene="Rbm4"
                     /codon_start=1
                     /product="RNA binding motif protein 4"
                     /protein_id="NP_001163955.1"
                     /db_xref="GeneID:293663"
                     /db_xref="RGD:1306891"
                     /translation="

MVKLFIGNLPREATEQEIRSLFEQYGKVLECDIIKNYGFVHIEDKTAAEDAIRNLHHYKLHGVNINVEASKNKSKASTKLHVGNISPTCTNQELRAKFEEYGPVIECDIVKDYAFVHMERAEDAVEAIRGLDNTEFQGKRMHVQLSTSRLRTAPGMGDQSGCYRCGKEGHWSKECPIDRSGRVADLTEQYNEQYGAVRTPYTMSYGDSLYYNNTYGALDAYYKRCRAARSYEAVAAAAASAYNNYAEQTLSQLPQVQNTAMASHLTSTSLDPYNRHLLPPSGAAAAAAAAAAAAAACTAASTPYYGRDRSPLRRATGPVPTVGEGYGYGHDSELSQASAAARNSLYDMARYEREQYADRARYSAF"

     misc_feature    100..300
                     /gene="Rbm4"
                     /note="RNA recognition motif 1 (RRM1) found in vertebrate
                     RNA-binding protein 4 (RBM4); Region: RRM1_RBM4; cd12606"
                     /db_xref="CDD:410018"
     misc_feature    328..528
                     /gene="Rbm4"
                     /note="RNA recognition motif 2 (RRM2) found in vertebrate
                     RNA-binding protein 4 (RBM4); Region: RRM2_RBM4; cd12607"
                     /db_xref="CDD:410019"
     misc_feature    <529..>639
                     /gene="Rbm4"
                     /note="universal minicircle sequence binding protein
                     (UMSBP); Provisional; Region: PTZ00368"
                     /db_xref="CDD:173561"
     misc_feature    577..624
                     /gene="Rbm4"
                     /note="zinc finger; Region: ZnF_C2HC; smart00343"
                     /db_xref="CDD:197667"
     exon            509..1202
                     /gene="Rbm4"
                     /inference="alignment:Splign:2.1.0"
     exon            1203..1444
                     /gene="Rbm4"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gagtcactgctgtggccgccgccattttagcgttttgtcagagccgtctacgctgcgaggaggaggacctgcagatttccatgcggctgtgtggagatggtgaaactgttcatcggaaatctgccccgggaggccacagagcaggagatccgctcactcttcgagcagtacgggaaggtgctggaatgtgacatcattaagaactatggctttgtgcacatagaggacaagacggccgctgaggatgccatacgcaacctgcaccactacaaactgcacggagtgaacatcaatgtggaagccagcaagaataagagcaaagcttcaaccaaattacatgtgggcaacatcagtcccacttgtaccaaccaagagcttcgggccaagtttgaggagtacggcccagtcatcgaatgtgacatcgtgaaagattatgcctttgtacacatggagcgggcagaagatgcggtggaggccatcaggggccttgacaacacagagtttcaaggcaaacgaatgcacgtgcagttgtccaccagccggcttaggaccgcgcccgggatgggagaccagagcggctgctatcggtgcgggaaagaggggcactggtccaaagagtgtccgatagaccgttcgggccgtgtggcagacttgaccgagcaatataatgagcaatatggagcagtgcgtacgccttacaccatgagttatggggattcattgtattacaacaacacgtacggagcgctcgatgcctactacaagcgctgccgtgctgcccggtcctatgaggcagtggcagctgcagctgcctctgcatataataactatgcagagcagactttgtcccagctgccacaagtccagaacacagccatggccagtcacctcacctccacctctcttgatccctacaatagacatctgttgccgccttcaggagctgctgcagcagcagctgctgctgctgctgctgctgctgcttgtactgcagcttctactccatattacgggcgggatcggagccccctgcgtcgcgctacaggcccagttcccactgttggagagggctacggttacgggcatgacagtgagttgtcccaagcttcagcagctgctcggaattccctgtacgacatggcccggtatgagcgggagcagtatgcggatcgggcgcggtactcagccttttaaagtttgaggtgggatgtgtgtgggctgaaattccgagctgcggttgtgcatgagaatacacccttcgtggtaccccatctccgggacgttctcggctctgtgcattcagtccctcaggaaccatggaccttaatttaccttgttaagttctttctctttcctattctctttcctgctcaatttcctgttctcctgtttattcttctgtaacttcccattcgagttctgttctcccagcatgcctcctatg

//