GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-07 06:28:19, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001135238            1582 bp    mRNA    linear   ROD 20-MAR-2023
DEFINITION  Rattus norvegicus twinfilin actin-binding protein 2 (Twf2), mRNA.
ACCESSION   NM_001135238 XM_001070490 XM_001070530
VERSION     NM_001135238.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1582)
  AUTHORS   Guo Z, Neilson LJ, Zhong H, Murray PS, Zanivan S and Zaidel-Bar R.
  TITLE     E-cadherin interactome complexity and robustness resolved by
            quantitative proteomics
  JOURNAL   Sci Signal 7 (354), rs7 (2014)
   PUBMED   25468996
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1582)
  AUTHORS   Castello A, Fischer B, Eichelbaum K, Horos R, Beckmann BM, Strein
            C, Davey NE, Humphreys DT, Preiss T, Steinmetz LM, Krijgsveld J and
            Hentze MW.
  TITLE     Insights into RNA biology from an atlas of mammalian mRNA-binding
            proteins
  JOURNAL   Cell 149 (6), 1393-1406 (2012)
   PUBMED   22658674
REFERENCE   3  (bases 1 to 1582)
  AUTHORS   Peng AW, Belyantseva IA, Hsu PD, Friedman TB and Heller S.
  TITLE     Twinfilin 2 regulates actin filament lengths in cochlear
            stereocilia
  JOURNAL   J Neurosci 29 (48), 15083-15088 (2009)
   PUBMED   19955359
REFERENCE   4  (bases 1 to 1582)
  AUTHORS   Gonzalez-Begne M, Lu B, Han X, Hagen FK, Hand AR, Melvin JE and
            Yates JR.
  TITLE     Proteomic analysis of human parotid gland exosomes by
            multidimensional protein identification technology (MudPIT)
  JOURNAL   J Proteome Res 8 (3), 1304-1314 (2009)
   PUBMED   19199708
REFERENCE   5  (bases 1 to 1582)
  AUTHORS   Nevalainen EM, Skwarek-Maruszewska A, Braun A, Moser M and
            Lappalainen P.
  TITLE     Two biochemically distinct and tissue-specific twinfilin isoforms
            are generated from the mouse Twf2 gene by alternative promoter
            usage
  JOURNAL   Biochem J 417 (2), 593-600 (2009)
   PUBMED   18837697
  REMARK    GeneRIF: like Twf1, mouse Twf2 is a filament barbed-end capping
            protein, and that two tissue-specific and biochemically distinct
            isoforms are generated from the Twf2 gene through alternative
            promoter usage.
REFERENCE   6  (bases 1 to 1582)
  AUTHORS   Yamada S, Uchimura E, Ueda T, Nomura T, Fujita S, Matsumoto K,
            Funeriu DP, Miyake M and Miyake J.
  TITLE     Identification of twinfilin-2 as a factor involved in neurite
            outgrowth by RNAi-based screen
  JOURNAL   Biochem Biophys Res Commun 363 (4), 926-930 (2007)
   PUBMED   17910947
REFERENCE   7  (bases 1 to 1582)
  AUTHORS   Vartiainen MK, Sarkkinen EM, Matilainen T, Salminen M and
            Lappalainen P.
  TITLE     Mammals have two twinfilin isoforms whose subcellular localizations
            and tissue distributions are differentially regulated
  JOURNAL   J Biol Chem 278 (36), 34347-34355 (2003)
   PUBMED   12807912
REFERENCE   8  (bases 1 to 1582)
  AUTHORS   Rohwer A, Kittstein W, Marks F and Gschwendt M.
  TITLE     Cloning, expression and characterization of an A6-related protein
  JOURNAL   Eur J Biochem 263 (2), 518-525 (1999)
   PUBMED   10406962
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CH473954.2.
            
            On or before Sep 28, 2008 this sequence version replaced
            XM_001070530.1, XM_001070490.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC158614.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMD00132264, SAMD00132266
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1582
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="8"
                     /map="8q32"
     gene            1..1582
                     /gene="Twf2"
                     /note="twinfilin actin-binding protein 2"
                     /db_xref="GeneID:684352"
                     /db_xref="RGD:1591460"
     exon            1..177
                     /gene="Twf2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    147..149
                     /gene="Twf2"
                     /note="upstream in-frame stop codon"
     CDS             153..1202
                     /gene="Twf2"
                     /codon_start=1
                     /product="twinfilin-2"
                     /protein_id="NP_001128710.1"
                     /db_xref="GeneID:684352"
                     /db_xref="RGD:1591460"
                     /translation="
MAHQTGIHATEELKEFFAKARAGSIRLIKVIIEDEQLVLGASQEPVGRWDQDYDRAVLPLLDAQEPCYLLFRLDSQNAQGFEWLFLAWSPDNSPVRLKMLYAATRATVKKEFGGGHIKDELFGTVKDDLSLAGYQKHLSSCAAPAPLTSAERELQQIRINEVKTEISVESKHQTLQGLAFPLQPEAQRALQQLKQKTVNYIQLKLDLERETIELVHTEPTNVAQLPSRVPRDAARYHFFLYKHTHEGDSLESVVFIYSMPGYKCSIKERMLYSSCKSRLLDSVEQDFQLEIAKKIEIGDGAELTAEFLYDEVHPKQHAFKQAFAKPKGPGGKRGHKRLIRGPGENGEDS"
     misc_feature    162..578
                     /gene="Twf2"
                     /note="N-terminal ADF domain of twinfilin and related
                     proteins; Region: ADF_Twf-N_like; cd11285"
                     /db_xref="CDD:200441"
     misc_feature    165..170
                     /gene="Twf2"
                     /note="putative G-actin interface [polypeptide binding];
                     other site"
                     /db_xref="CDD:200441"
     misc_feature    678..1085
                     /gene="Twf2"
                     /note="C-terminal ADF domain of twinfilin and related
                     proteins; Region: ADF_Twf-C_like; cd11284"
                     /db_xref="CDD:200440"
     misc_feature    order(678..692,780..782,921..923,927..929,936..938,
                     948..953,957..965,969..974,978..980,1032..1034,1038..1040,
                     1044..1046)
                     /gene="Twf2"
                     /note="G-actin binding interface [polypeptide binding];
                     other site"
                     /db_xref="CDD:200440"
     misc_feature    order(951..953,1047..1049,1056..1058)
                     /gene="Twf2"
                     /note="putative F-actin interface [polypeptide binding];
                     other site"
                     /db_xref="CDD:200440"
     exon            178..255
                     /gene="Twf2"
                     /inference="alignment:Splign:2.1.0"
     exon            256..434
                     /gene="Twf2"
                     /inference="alignment:Splign:2.1.0"
     exon            435..530
                     /gene="Twf2"
                     /inference="alignment:Splign:2.1.0"
     exon            531..635
                     /gene="Twf2"
                     /inference="alignment:Splign:2.1.0"
     exon            636..761
                     /gene="Twf2"
                     /inference="alignment:Splign:2.1.0"
     exon            762..912
                     /gene="Twf2"
                     /inference="alignment:Splign:2.1.0"
     exon            913..1034
                     /gene="Twf2"
                     /inference="alignment:Splign:2.1.0"
     exon            1035..1582
                     /gene="Twf2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gggggcgggtcctgcggcaccgcccgggaagctgcgcgaagctcggcgccgtcgccacatcctccggagctctgggtccaggcgagccgagtcgagccgggccaggacctagcggagagctccgacggcacgggcgagccgaacgctgagccatggcgcaccagaccggcatccacgccactgaagagctaaaggaattctttgccaaggcccgggctggctccatccgacttatcaaagtcatcattgaggacgagcagctcgtgctgggtgcctcgcaggagccagtgggacgctgggaccaggactacgacagggccgtgctaccgctgctagatgcccaagagccctgctacctcctcttccgacttgattcgcagaatgcccagggtttcgagtggcttttcctggcctggtcacctgacaattcgcctgtgcggctgaagatgctgtatgcagccacacgagccacagttaagaaggagtttggaggtggccacatcaaggatgagctcttcgggacagtaaaggatgacctctccttggctgggtaccagaagcacctgtcatcctgtgctgcaccggccccactgacttccgccgagcgagagctccagcagatccgaatcaatgaggtgaagactgagatcagtgtggagagtaagcaccagaccctgcagggcctggccttccccctgcagcctgaggcccagcgggcacttcagcaactcaagcagaagacggtcaactatatccagctgaagctggacctggaacgggagaccatcgagctggtacacacagaacccacaaatgtggcccagctgccctcacgggtaccccgagatgctgcccgctaccacttcttcctgtataagcatacccatgagggtgactccctcgaatctgtggtgttcatctactccatgccggggtacaagtgcagcattaaggagcgcatgctctactccagctgcaagagccgcctccttgactctgtggagcaggacttccagctggagatcgctaagaagattgagatcggcgatggggcggagctcaccgccgagttcctctatgatgaggtgcatcccaagcagcacgccttcaagcaggcattcgccaagcccaaaggccctggaggcaagcggggccacaagcgcctcatccggggccccggggagaatggggaagacagctaggtgtctggcctgggaacagggcagggcacatggactgcagggttgccacccgtcacccctgcgcttccttcctccccggcctgggctctaaggaaccgcttcctgtgggacaggaggacaggtggctgagcacatttgctacttctgagggcctctggaccagcacttcgtgacctcgccctgtcactgttcctgactctcctctgtgtgcacagcccccctggtgcacacctagcctccagacgatttcatgctatggttccagcccagtccaaaagccgttggctacagagggtggggacagttggcaggggccagatatcacaggaagggttggttgaatgctgtattttgtaaagaataaaatatttttaaatcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]