ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-25 04:10:20, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001106732 1078 bp mRNA linear ROD 20-MAR-2023 DEFINITION Rattus norvegicus NK2 homeobox 8 (Nkx2-8), mRNA. ACCESSION NM_001106732 XM_001079326 XM_234179 VERSION NM_001106732.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1078) AUTHORS Tian J, Mahmood R, Hnasko R and Locker J. TITLE Loss of Nkx2.8 deregulates progenitor cells in the large airways and leads to dysplasia JOURNAL Cancer Res 66 (21), 10399-10407 (2006) PUBMED 17079460 REFERENCE 2 (bases 1 to 1078) AUTHORS Dillon AK, Fujita SC, Matise MP, Jarjour AA, Kennedy TE, Kollmus H, Arnold HH, Weiner JA, Sanes JR and Kaprielian Z. TITLE Molecular control of spinal accessory motor neuron/axon development in the mouse spinal cord JOURNAL J Neurosci 25 (44), 10119-10130 (2005) PUBMED 16267219 REFERENCE 3 (bases 1 to 1078) AUTHORS Kajiyama Y, Tian J and Locker J. TITLE Regulation of alpha-fetoprotein expression by Nkx2.8 JOURNAL Mol Cell Biol 22 (17), 6122-6130 (2002) PUBMED 12167706 REFERENCE 4 (bases 1 to 1078) AUTHORS Apergis GA, Crawford N, Ghosh D, Steppan CM, Vorachek WR, Wen P and Locker J. TITLE A novel nk-2-related transcription factor associated with human fetal liver and hepatocellular carcinoma JOURNAL J Biol Chem 273 (5), 2917-2925 (1998) PUBMED 9446603 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from CH473947.1. On or before Oct 4, 2007 this sequence version replaced XM_234179.4, XM_001079326.1. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMN16676784, SAMN16676785 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1078 /organism="Rattus norvegicus" /mol_type="mRNA" /db_xref="taxon:10116" /chromosome="6" /map="6q23" gene 1..1078 /gene="Nkx2-8" /gene_synonym="Nkx2-9" /note="NK2 homeobox 8" /db_xref="GeneID:299061" /db_xref="RGD:1310629" exon 1..372 /gene="Nkx2-8" /gene_synonym="Nkx2-9" /inference="alignment:Splign:2.1.0" misc_feature 186..188 /gene="Nkx2-8" /gene_synonym="Nkx2-9" /note="upstream in-frame stop codon" CDS 225..929 /gene="Nkx2-8" /gene_synonym="Nkx2-9" /note="NK2 transcription factor related, locus 9" /codon_start=1 /product="homeobox protein Nkx-2.8" /protein_id="NP_001100202.1" /db_xref="GeneID:299061" /db_xref="RGD:1310629" /translation="
MASSGRLGFTVRSLLNLPEQDAQPRVRCEQQTCVPQTAAWLESERSHYPSSDESGLETSPADSSQLASLGRASPGSDAEKRRKRRVLFSKAQTLELERRFRQQRYLSAPEREQLARLLRLTPTQVKIWFQNHRYKLKRGRAPGVTESSDVTASADLHAAPGLLRRVVVPVLVHDRSPCNGRGEGTAAVPQDKCSSRLATACPVQGYTAFGPGSALGLFPAYQHLAPPALVSWNW"
misc_feature 468..638
/gene="Nkx2-8"
/gene_synonym="Nkx2-9"
/note="Region: Homeodomain; pfam00046"
/db_xref="CDD:459649"
exon 373..1078
/gene="Nkx2-8"
/gene_synonym="Nkx2-9"
/inference="alignment:Splign:2.1.0"
ORIGIN
cactcattcaggtacttaagaccccggacacccggaccgtggctttcaaagcccaccgagtggcaagggctgtttataaaaacagggattcctccgcaaaggcgctgataacctgaggccagcgcatggcgagcgcctcccacttccatccttaggagcggcgtccccaggcgtccctgggttcctagcctgccctgccccccaccttcttcccctcctgggccatggcctcctctggacgcctcggcttcaccgtgcgaagcctcctgaatttacccgaacaggatgcgcagcccagggtgaggtgcgagcaacagacgtgcgttcctcagacggccgcctggctggagtcggagcgcagccactacccgtcctctgatgaaagcggcctggagactagccctgcagactcgtcgcagctggcttccctcgggcgggcgtcccctggctccgacgcagagaagaggaggaagcggcgggtgctgttctccaaggcccagactttggagttggagcggcgctttcggcagcagcggtacctgtcggcgcccgagcgggaacagctggctcgacttctgcgcctcacgcccacgcaggtcaagatctggttccagaaccaccgctacaagctgaagcgtgggcgagcgccaggggtcacagaatcttcggatgtgacagcatcagctgatctgcacgccgctcccggcctgctgcgccgcgtagtggtacccgtgctggttcacgaccgatcaccgtgcaatggcaggggtgaggggaccgctgcggtgccccaggacaagtgcagctcacgcctggccactgcgtgcccagtgcaaggttacactgccttcggaccgggctcagcattaggcctcttccctgcctaccagcacttagcaccaccagctctggtctcctggaactggtgaggctgctgcgaggtgcctagagccgccctaggcttgggacattgctgtttggcctgccgcagtagcgctacagccgcaccaaactcaggaagtgacccttgcaggatccactcttgagtcctgggtccctgggttgctctaaccagcaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]