GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-03-13 12:58:03, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       NM_001106732            1078 bp    mRNA    linear   ROD 20-MAR-2023
DEFINITION  Rattus norvegicus NK2 homeobox 8 (Nkx2-8), mRNA.
ACCESSION   NM_001106732 XM_001079326 XM_234179
VERSION     NM_001106732.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1078)
  AUTHORS   Tian J, Mahmood R, Hnasko R and Locker J.
  TITLE     Loss of Nkx2.8 deregulates progenitor cells in the large airways
            and leads to dysplasia
  JOURNAL   Cancer Res 66 (21), 10399-10407 (2006)
   PUBMED   17079460
REFERENCE   2  (bases 1 to 1078)
  AUTHORS   Dillon AK, Fujita SC, Matise MP, Jarjour AA, Kennedy TE, Kollmus H,
            Arnold HH, Weiner JA, Sanes JR and Kaprielian Z.
  TITLE     Molecular control of spinal accessory motor neuron/axon development
            in the mouse spinal cord
  JOURNAL   J Neurosci 25 (44), 10119-10130 (2005)
   PUBMED   16267219
REFERENCE   3  (bases 1 to 1078)
  AUTHORS   Kajiyama Y, Tian J and Locker J.
  TITLE     Regulation of alpha-fetoprotein expression by Nkx2.8
  JOURNAL   Mol Cell Biol 22 (17), 6122-6130 (2002)
   PUBMED   12167706
REFERENCE   4  (bases 1 to 1078)
  AUTHORS   Apergis GA, Crawford N, Ghosh D, Steppan CM, Vorachek WR, Wen P and
            Locker J.
  TITLE     A novel nk-2-related transcription factor associated with human
            fetal liver and hepatocellular carcinoma
  JOURNAL   J Biol Chem 273 (5), 2917-2925 (1998)
   PUBMED   9446603
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CH473947.1.
            
            On or before Oct 4, 2007 this sequence version replaced
            XM_234179.4, XM_001079326.1.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMN16676784,
                              SAMN16676785 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1078
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="6"
                     /map="6q23"
     gene            1..1078
                     /gene="Nkx2-8"
                     /gene_synonym="Nkx2-9"
                     /note="NK2 homeobox 8"
                     /db_xref="GeneID:299061"
                     /db_xref="RGD:1310629"
     exon            1..372
                     /gene="Nkx2-8"
                     /gene_synonym="Nkx2-9"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    186..188
                     /gene="Nkx2-8"
                     /gene_synonym="Nkx2-9"
                     /note="upstream in-frame stop codon"
     CDS             225..929
                     /gene="Nkx2-8"
                     /gene_synonym="Nkx2-9"
                     /note="NK2 transcription factor related, locus 9"
                     /codon_start=1
                     /product="homeobox protein Nkx-2.8"
                     /protein_id="NP_001100202.1"
                     /db_xref="GeneID:299061"
                     /db_xref="RGD:1310629"
                     /translation="
MASSGRLGFTVRSLLNLPEQDAQPRVRCEQQTCVPQTAAWLESERSHYPSSDESGLETSPADSSQLASLGRASPGSDAEKRRKRRVLFSKAQTLELERRFRQQRYLSAPEREQLARLLRLTPTQVKIWFQNHRYKLKRGRAPGVTESSDVTASADLHAAPGLLRRVVVPVLVHDRSPCNGRGEGTAAVPQDKCSSRLATACPVQGYTAFGPGSALGLFPAYQHLAPPALVSWNW"
     misc_feature    468..638
                     /gene="Nkx2-8"
                     /gene_synonym="Nkx2-9"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            373..1078
                     /gene="Nkx2-8"
                     /gene_synonym="Nkx2-9"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
cactcattcaggtacttaagaccccggacacccggaccgtggctttcaaagcccaccgagtggcaagggctgtttataaaaacagggattcctccgcaaaggcgctgataacctgaggccagcgcatggcgagcgcctcccacttccatccttaggagcggcgtccccaggcgtccctgggttcctagcctgccctgccccccaccttcttcccctcctgggccatggcctcctctggacgcctcggcttcaccgtgcgaagcctcctgaatttacccgaacaggatgcgcagcccagggtgaggtgcgagcaacagacgtgcgttcctcagacggccgcctggctggagtcggagcgcagccactacccgtcctctgatgaaagcggcctggagactagccctgcagactcgtcgcagctggcttccctcgggcgggcgtcccctggctccgacgcagagaagaggaggaagcggcgggtgctgttctccaaggcccagactttggagttggagcggcgctttcggcagcagcggtacctgtcggcgcccgagcgggaacagctggctcgacttctgcgcctcacgcccacgcaggtcaagatctggttccagaaccaccgctacaagctgaagcgtgggcgagcgccaggggtcacagaatcttcggatgtgacagcatcagctgatctgcacgccgctcccggcctgctgcgccgcgtagtggtacccgtgctggttcacgaccgatcaccgtgcaatggcaggggtgaggggaccgctgcggtgccccaggacaagtgcagctcacgcctggccactgcgtgcccagtgcaaggttacactgccttcggaccgggctcagcattaggcctcttccctgcctaccagcacttagcaccaccagctctggtctcctggaactggtgaggctgctgcgaggtgcctagagccgccctaggcttgggacattgctgtttggcctgccgcagtagcgctacagccgcaccaaactcaggaagtgacccttgcaggatccactcttgagtcctgggtccctgggttgctctaaccagcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]