LOCUS       NM_001106602             997 bp    mRNA    linear   ROD 22-MAR-2023
DEFINITION  Rattus norvegicus deoxyguanosine kinase (Dguok), mRNA; nuclear gene
            for mitochondrial product.
ACCESSION   NM_001106602 XM_001068249 XM_216194
VERSION     NM_001106602.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 997)
  AUTHORS   Vanden Avond MA, Meng H, Beatka MJ, Helbling DC, Prom MJ, Sutton
            JL, Slick RA, Dimmock DP, Pertusati F, Serpi M, Pileggi E, Crutcher
            P, Thomas S and Lawlor MW.
  TITLE     The nucleotide prodrug CERC-913 improves mtDNA content in primary
            hepatocytes from DGUOK-deficient rats
  JOURNAL   J Inherit Metab Dis 44 (2), 492-501 (2021)
   PUBMED   33368311
  REMARK    GeneRIF: The nucleotide prodrug CERC-913 improves mtDNA content in
            primary hepatocytes from DGUOK-deficient rats.
REFERENCE   2  (bases 1 to 997)
  AUTHORS   Zhou X, Curbo S, Zhao Q, Krishnan S, Kuiper R and Karlsson A.
  TITLE     Severe mtDNA depletion and dependency on catabolic lipid metabolism
            in DGUOK knockout mice
  JOURNAL   Hum Mol Genet 28 (17), 2874-2884 (2019)
   PUBMED   31127938
REFERENCE   3  (bases 1 to 997)
  AUTHORS   Jing R, Corbett JL, Cai J, Beeson GC, Beeson CC, Chan SS, Dimmock
            DP, Lazcares L, Geurts AM, Lemasters JJ and Duncan SA.
  TITLE     A Screen Using iPSC-Derived Hepatocytes Reveals NAD+ as a Potential
            Treatment for mtDNA Depletion Syndrome
  JOURNAL   Cell Rep 25 (6), 1469-1484 (2018)
   PUBMED   30404003
REFERENCE   4  (bases 1 to 997)
  AUTHORS   Bennett B, Helbling D, Meng H, Jarzembowski J, Geurts AM,
            Friederich MW, Van Hove JLK, Lawlor MW and Dimmock DP.
  TITLE     Potentially diagnostic electron paramagnetic resonance spectra
            elucidate the underlying mechanism of mitochondrial dysfunction in
            the deoxyguanosine kinase deficient rat model of a genetic
            mitochondrial DNA depletion syndrome
  JOURNAL   Free Radic Biol Med 92, 141-151 (2016)
   PUBMED   26773591
  REMARK    GeneRIF: The goals of this work are to characterize the DGUOK rat
            in terms of mitochondrial dysfunction and pathological outcome, and
            to evaluate EPR as a new and additional technique in an integrated
            characterization of mitochondrial disease .
REFERENCE   5  (bases 1 to 997)
  AUTHORS   de Mateo S, Castillo J, Estanyol JM, Ballesca JL and Oliva R.
  TITLE     Proteomic characterization of the human sperm nucleus
  JOURNAL   Proteomics 11 (13), 2714-2726 (2011)
   PUBMED   21630459
REFERENCE   6  (bases 1 to 997)
  AUTHORS   Johansson K, Ramaswamy S, Ljungcrantz C, Knecht W, Piskur J,
            Munch-Petersen B, Eriksson S and Eklund H.
  TITLE     Structural basis for substrate specificities of cellular
            deoxyribonucleoside kinases
  JOURNAL   Nat Struct Biol 8 (7), 616-620 (2001)
   PUBMED   11427893
  REMARK    Erratum:[Nat Struct Biol 2001 Sep;8(9):818-9]
REFERENCE   7  (bases 1 to 997)
  AUTHORS   Petrakis TG, Ktistaki E, Wang L, Eriksson S and Talianidis I.
  TITLE     Cloning and characterization of mouse deoxyguanosine kinase.
            Evidence for a cytoplasmic isoform
  JOURNAL   J Biol Chem 274 (35), 24726-24730 (1999)
   PUBMED   10455141
REFERENCE   8  (bases 1 to 997)
  AUTHORS   Wang L, Hellman U and Eriksson S.
  TITLE     Cloning and expression of human mitochondrial deoxyguanosine kinase
            cDNA
  JOURNAL   FEBS Lett 390 (1), 39-43 (1996)
   PUBMED   8706825
REFERENCE   9  (bases 1 to 997)
  AUTHORS   Snyder FF, Jenuth JP, Dilay JE, Fung E, Lightfoot T and Mably ER.
  TITLE     Secondary loss of deoxyguanosine kinase activity in purine
            nucleoside phosphorylase deficient mice
  JOURNAL   Biochim Biophys Acta 1227 (1-2), 33-40 (1994)
   PUBMED   7918681
REFERENCE   10 (bases 1 to 997)
  AUTHORS   Jenuth JP, Dilay JE, Fung E, Mably ER and Snyder FF.
  TITLE     Absence of dGTP accumulation and compensatory loss of
            deoxyguanosine kinase in purine nucleoside phosphorylase deficient
            mice
  JOURNAL   Adv Exp Med Biol 309B, 273-276 (1991)
   PUBMED   1664183
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CH473957.1.
            
            On or before Oct 4, 2007 this sequence version replaced
            XM_001068249.1, XM_216194.4.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support SAMD00132261,
                              SAMD00132262 [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            gene product(s) localized to mito. :: inferred from homology
            RefSeq Select criteria             :: based on conservation
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..997
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="4"
                     /map="4q34"
     gene            1..997
                     /gene="Dguok"
                     /note="deoxyguanosine kinase"
                     /db_xref="GeneID:297389"
                     /db_xref="RGD:1304799"
     exon            1..197
                     /gene="Dguok"
                     /inference="alignment:Splign:2.1.0"
     CDS             56..892
                     /gene="Dguok"
                     /EC_number="2.7.1.113"
                     /codon_start=1
                     /product="deoxyguanosine kinase, mitochondrial"
                     /protein_id="NP_001100072.1"
                     /db_xref="GeneID:297389"
                     /db_xref="RGD:1304799"
                     /translation="

MAAGRFLLRRLRASFRSQPRNALVDAPRARGMHDGGGPRRLCIEGNIAVGKSTFVKLLTKTHPEWQVATEPIATWQNVQAAGTQKDSTSRRLGNLLDMMYQEPARWSYTFQTLSFMSRLKVQLEPTPGRLLQADTSVRVFERSVYSDRYIFAKNLFENGSLSDVEWHIYQDWHSFLLQEFEDRLLLHGFIYLQASPQVCMERLCQRGREEEKGIELAYLKQLHGQHEDWFINKTTKLHFEALRHVPVLVLNISEDFSENAAKQEELMGQQGDSDNRRE"

     misc_feature    176..862
                     /gene="Dguok"
                     /note="Deoxynucleoside kinase; Region: dNK; pfam01712"
                     /db_xref="CDD:396326"
     misc_feature    order(200..202,206..211,353..355,383..388,506..508,
                     671..673,686..688)
                     /gene="Dguok"
                     /note="Substrate-binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:238836"
     misc_feature    407..409
                     /gene="Dguok"
                     /note="Substrate specificity [chemical binding]; other
                     site"
                     /db_xref="CDD:238836"
     exon            198..310
                     /gene="Dguok"
                     /inference="alignment:Splign:2.1.0"
     exon            311..498
                     /gene="Dguok"
                     /inference="alignment:Splign:2.1.0"
     exon            499..646
                     /gene="Dguok"
                     /inference="alignment:Splign:2.1.0"
     exon            647..762
                     /gene="Dguok"
                     /inference="alignment:Splign:2.1.0"
     exon            763..862
                     /gene="Dguok"
                     /inference="alignment:Splign:2.1.0"
     exon            863..997
                     /gene="Dguok"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

accgcaggcggaagtgccctcggcggaagtgcccgccttgctaagcttgggtaggatggctgcaggtcggttccttctgcgtagactccgagcgtctttccgttcccagcctcggaacgcgctcgtggacgcaccacgcgccaggggcatgcacgacgggggcggcccccgaaggctctgcattgaaggcaacatcgctgtgggcaaatccacctttgtgaagttactcacgaaaactcacccagagtggcaagtggctacagaacctatagcaacatggcagaatgtccaggctgctggcacccaaaaagatagcacttccagacgtcttggaaacttgctagacatgatgtaccaggagccagcacgatggtcctacacatttcagaccctctccttcatgagccggctgaaagtgcagttggagcccaccccagggagactcctgcaggcagacacgtctgtgagggtctttgagagatctgtgtacagtgacaggtatatctttgcgaagaatctgtttgaaaatggctccctcagtgacgtcgaatggcacatctatcaggactggcactccttcctcctgcaggagtttgaagaccggcttttgttacatggcttcatctacctccaggcttctccccaggtttgcatggaaagactgtgtcagaggggcagagaagaagagaaagggattgagttggcctatcttaaacagctacatgggcaacatgaagactggtttattaacaagactaccaagctccacttcgaggctctgcggcatgtgccggtgctggtgttgaacatcagtgaggatttctctgaaaatgccgccaaacaagaagagctcatggggcagcagggagattcagacaacaggagggagtgatgctcacagcacggaagacagagtgcgacggtgccaagacttaccatcctttatgctttgagaaagtgttgggttctttactaataaatacataaggttttcaac

//