GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-05 06:55:32, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001100639            2566 bp    mRNA    linear   ROD 08-NOV-2023
DEFINITION  Rattus norvegicus POU class 2 homeobox 1 (Pou2f1), mRNA.
ACCESSION   NM_001100639 XM_001075635 XM_341148
VERSION     NM_001100639.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2566)
  AUTHORS   Gu YH, Wang J, Lu WC, Cheng Y, Tao R, Zhang SJ, Xu T, Zhai KW, Luo
            SX and Xin WJ.
  TITLE     POU2F1/DNMT3a Pathway Participates in Neuropathic Pain by
            Hypermethylation-Mediated LRFN4 Downregulation Following
            Oxaliplatin Treatment
  JOURNAL   Neurochem Res 48 (12), 3652-3664 (2023)
   PUBMED   37592110
  REMARK    GeneRIF: POU2F1/DNMT3a Pathway Participates in Neuropathic Pain by
            Hypermethylation-Mediated LRFN4 Downregulation Following
            Oxaliplatin Treatment.
REFERENCE   2  (bases 1 to 2566)
  AUTHORS   Zhang WF, Zhu TT, Xiong YW, Xiong AZ, Ge XY, Hu CP and Zhang Z.
  TITLE     Negative feedback regulation between microRNA let-7g and LOX-1
            mediated hypoxia-induced PASMCs proliferation
  JOURNAL   Biochem Biophys Res Commun 488 (4), 655-663 (2017)
   PUBMED   28108289
  REMARK    Erratum:[Biochem Biophys Res Commun. 2017 Oct 21;492(3):529. PMID:
            28851539]
REFERENCE   3  (bases 1 to 2566)
  AUTHORS   Gahete MD, Duran-Prado M, Delgado-Niebla E, Garrido JJ, Rhodes SJ,
            Garcia-Navarro S, Gracia-Navarro F, Malagon MM, Luque RM and
            Castano JP.
  TITLE     Porcine sst1 can physically interact with other somatostatin
            receptors, and its expression is regulated by
            metabolic/inflammatory sensors
  JOURNAL   Am J Physiol Endocrinol Metab 306 (5), E483-E493 (2014)
   PUBMED   24368669
REFERENCE   4  (bases 1 to 2566)
  AUTHORS   Dumay-Odelot H, Durrieu-Gaillard S, Da Silva D, Roeder RG and
            Teichmann M.
  TITLE     Cell growth- and differentiation-dependent regulation of RNA
            polymerase III transcription
  JOURNAL   Cell Cycle 9 (18), 3687-3699 (2010)
   PUBMED   20890107
  REMARK    Review article
REFERENCE   5  (bases 1 to 2566)
  AUTHORS   Wang P, Wang Q, Sun J, Wu J, Li H, Zhang N, Huang Y, Su B, Li RK,
            Liu L, Zhang Y, Elsholtz HP, Hu J, Gaisano HY and Jin T.
  TITLE     POU homeodomain protein Oct-1 functions as a sensor for cyclic AMP
  JOURNAL   J Biol Chem 284 (39), 26456-26465 (2009)
   PUBMED   19617623
  REMARK    GeneRIF: Data show that cAMP elevation reduces nuclear Oct-1
            content in primary pancreatic islet cells.
REFERENCE   6  (bases 1 to 2566)
  AUTHORS   Dailey L, Yuan H and Basilico C.
  TITLE     Interaction between a novel F9-specific factor and octamer-binding
            proteins is required for cell-type-restricted activity of the
            fibroblast growth factor 4 enhancer
  JOURNAL   Mol Cell Biol 14 (12), 7758-7769 (1994)
   PUBMED   7969117
REFERENCE   7  (bases 1 to 2566)
  AUTHORS   Rosfjord E and Rizzino A.
  TITLE     The octamer motif present in the Rex-1 promoter binds Oct-1 and
            Oct-3 expressed by EC cells and ES cells
  JOURNAL   Biochem Biophys Res Commun 203 (3), 1795-1802 (1994)
   PUBMED   7945330
REFERENCE   8  (bases 1 to 2566)
  AUTHORS   Lillycrop KA and Latchman DS.
  TITLE     Cloning and sequencing of the rat Oct-1 POU box
  JOURNAL   Nucleic Acids Res 19 (13), 3744 (1991)
   PUBMED   1677182
REFERENCE   9  (bases 1 to 2566)
  AUTHORS   Timchenko NA, Zhuchenko OP, Timchenko LT, Iguchi-Ariga SM, Ariga H,
            Bozhkov VM and Tomilin NV.
  TITLE     Rat DNA sequence associated with a complex form of DNA polymerase
            alpha in nonregenerating liver interacts with a ubiquitous
            transcription/replication factor Oct-1
  JOURNAL   Biomed Sci 2 (6), 595-600 (1991)
   PUBMED   1841628
REFERENCE   10 (bases 1 to 2566)
  AUTHORS   Scholer HR, Ruppert S, Suzuki N, Chowdhury K and Gruss P.
  TITLE     New type of POU domain in germ line-specific protein Oct-4
  JOURNAL   Nature 344 (6265), 435-439 (1990)
   PUBMED   1690859
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DV214198.1 and U17013.1.
            
            On or before Dec 17, 2009 this sequence version replaced
            XM_341148.3, XM_001075635.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support SAMD00132261,
                              SAMD00132262 [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-410               DV214198.1         1-410
            411-2566            U17013.1           1-2156
FEATURES             Location/Qualifiers
     source          1..2566
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="13"
                     /map="13q23"
     gene            1..2566
                     /gene="Pou2f1"
                     /note="POU class 2 homeobox 1"
                     /db_xref="GeneID:171068"
                     /db_xref="RGD:621689"
     exon            1..63
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     CDS             3..2309
                     /gene="Pou2f1"
                     /note="NF-A1; OTF-1; oct-1; octamer-binding transcription
                     factor 1; octamer-binding protein 1"
                     /codon_start=1
                     /product="POU domain, class 2, transcription factor 1"
                     /protein_id="NP_001094109.1"
                     /db_xref="GeneID:171068"
                     /db_xref="RGD:621689"
                     /translation="
MADGGAASQDESSAAAAAAADSRMNNPSETNKSSMESGDASTGTQTNGLDFEKQPVPVGGAISTAQAQAFLGHLHQVQLAGTSLQAAAQSLNVQSKSSEESGDSQQSSQPSQQPSVQSAIPQTQLMLAGGQITGLTLTPAQQQLLLQQAQAQAQLLAAAVQQHSASQQHSAAGATISASAATPMTQIPLSQPIQIAQDLQQLQQLQQQNLNLQQFVLVHPTTNLQPAQFIISQTPQGQQGLLQAQNLLTQLPQQSQANLLQPQPSITLTSQPTTPTRTIAATPIQTLPQSQTTPKRIDTPSLEEPSDLEELEQFAKTFKQRRIKLGFTQGDVGLAMGKLYGNDFSQTTISRFEALNLSFKNMCKLKPLLEKWLNDAENLSSDSTASSPSALNSPGLGAEGLNRRRKKRTSIETNIRVALEKSFMENQKPTSEDITLIAEQLNMEKEVIRVWFCNRRQKEKRINPPSSGGTSSSPIKAIFPSPTSLVATTPSLVTSSTATTLTVNPVLPLTSAAMTNLSLTGTTDSTSNNTATVISTAPPASSAVTSPSLSPSPSASASTSEASSASETSTTQTTSTPLPSPLGASQVMVTASGLQTAAAAALQGAAQLPANASLAAMAAAAGLNPGLMAPSQFAAGGALLSLNPGTLGGALSPALMSNSTLATIQALASSGSLPITSLDATGNLVFANAGGAPNIVTAPLFLNPQNLSLLTSNPVSLVSAAAASTGNSAPTASLHASSTSTESIQNSLFTVASASGAASTTTAASKAQ"
     misc_feature    909..1133
                     /gene="Pou2f1"
                     /note="Found in Pit-Oct-Unc transcription factors; Region:
                     POU; smart00352"
                     /db_xref="CDD:197673"
     misc_feature    order(1215..1229,1233..1235,1284..1286,1302..1304,
                     1341..1343,1347..1352,1359..1364,1368..1376,1380..1385)
                     /gene="Pou2f1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    1221..1382
                     /gene="Pou2f1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(1221..1223,1230..1232,1350..1352,1359..1364,
                     1371..1373)
                     /gene="Pou2f1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    1425..2264
                     /gene="Pou2f1"
                     /note="POU domain, class 2, transcription factor 1
                     C-terminal; Region: POU2F1_C; pfam19536"
                     /db_xref="CDD:437368"
     exon            64..129
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            130..230
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            231..284
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            285..404
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            405..593
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            594..720
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            721..815
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            816..989
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            990..1131
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            1132..1277
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            1278..1457
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            1458..1563
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            1564..1909
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            1910..1998
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
     exon            1999..2566
                     /gene="Pou2f1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
aaatggcggacggaggagcagcgagtcaagatgagagttcagccgcggcggcagcagcagcagactcaagaatgaacaatccgtcagaaaccaataagtcatctatggagagtggagatgccagcacaggcacacagaccaatggcctggactttgagaagcagcccgtgcctgtcggaggggccatctccacagcccaggcccaggctttccttgggcatcttcaccaggtccagctcgctgggacaagtttacaggctgctgctcaatctttaaatgtacagtctaaatctagtgaagagtccggagattcgcagcagtcaagccagccttcccagcagccttcagtgcagtcagccattccccagactcagctaatgctggccgggggacagataactgggctcacactgacaccagcccagcaacagcttttactacagcaggcccaggcccaggcccagctcctggctgctgcagtgcagcaacactccgccagccaacagcacagtgctgctggggccaccatctcagcctccgctgccacacccatgacgcagatccccctgtctcagcccatacagattgcacaggatcttcaacaattgcaacagcttcagcagcaaaatctcaacttgcaacagttcgtcttggtgcacccaaccaccaacttgcaaccagcacagtttatcatctctcagaccccccagggccagcagggtctcctgcaagcgcaaaatcttttaacgcaactacctcagcaaagccaagccaacctcctacagccacagccaagcatcaccctcacgtcccagcctaccaccccaactcgcacaatagcagcaaccccaattcagacacttccacagagccagacaacaccaaagcgaattgatactcccagcttggaggagcccagtgaccttgaggagcttgagcaatttgccaagacttttaaacaaagacgaatcaaacttggattcactcagggtgatgttgggcttgctatggggaaattatatggaaatgacttcagccaaaccaccatctctcgctttgaagccttgaacctcagctttaagaacatgtgcaagttaaagccccttttagagaagtggctaaatgacgcggagaacctctcatctgattctacagcatctagcccaagtgctttgaattctccagggttgggggctgagggcttgaatcgtaggaggaaaaaacgcaccagcatagagaccaacatccgtgtggccttagaaaagagtttcatggagaatcaaaagcctacctcggaagatatcaccttgattgctgaacagctcaatatggagaaggaggtgattcgtgtttggttttgtaaccgccgccagaaggagaaaagaatcaacccgccaagcagtggtgggaccagcagctcaccaatcaaagcaattttccccagcccaacctcactggtggcaaccactccaagccttgtgacaagcagtacagcaactaccctcacagtcaaccctgtgctccccttaaccagtgctgccatgactaatctttctcttacaggcactacagactccacgtccaacaacacggccaccgtgatttccacagcaccccctgcttcctcagcagtcacatctccctccttgagtccctctccttctgcctcagcctccacctctgaggcctctagtgccagcgagaccagcacaacacagaccacctccacacctctcccctcccctcttggagccagccaggtgatggtgacagcctctggcttacagactgcagccgccgctgctctccaaggagctgcacagttgccagcaaatgccagtcttgctgctatggctgctgctgcaggactcaatccaggcctgatggcaccctcacagtttgctgctggaggtgccttactcagtctcaatccggggaccctgggtggggctctcagcccggccctgatgagcaacagtacactggcaaccattcaagctcttgcttctagtggctctcttccaataacatctctggatgcaactgggaacctggtattcgccaatgcaggaggagcccccaacatcgtgactgcccctctgttcctgaaccctcagaacctctctctgctcaccagcaacccagtaagcttggtttctgccgctgcagcctccacagggaactccgcacctacagccagccttcatgcctcctccacctcaactgagtccatccagaactctctgttcacagtggcctctgccagcggggctgcctccaccaccacagctgcctccaaggcacagtgagctggacgcagagctggggctttcctcactgcagggtgataggctggctatcagctggctaaaacatgacgcctgtcattggcttcctcccaccatgttgtgaggatgaggaagacatggagagaagaaaaaaattacacataacaacaaaaaaaaagaatggagacaggacaacgtttgcctaattttataataaaaacaatgtcttttcaggattgcttcatggattggagaactttctaaccaaaaattttaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]