GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2022-01-24 13:14:22, GGRNA : RefSeq release 209 (Nov, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Oryza sativa Japonica Group B-cell receptor-associated protein 31 (LOC4329170), mRNA. (1252 bp)
gcctccacgctctacagcatggccgagatcagcggccgcgccgggggagaccccgaatccggcggcggcggcggcggcgcctccctctcgcccaccgaccaggtcctcttctcgcggcacctcctcgaggcatccctcatggggtattccttatttcttgctctagttattgaccggctccaccaatacatcagagagctacgtgggctaaagaagaatgttgaggccgtaactaagcataataaaatgttggaggaagcaaaacatggaagatctgaggagacaaagaaataccaagaagagattggtgctctcaatgaggatatgaagaaactgaagctacaagtccaagaaaagacagaggaagtccacgttgctgaggacaaggctcttgctattcggaaacaatctgaaagcctgctgcttgagtatgaccgtttgctggaggacaaccagcatctccgggagcagctgcagtcaattgaccacaggctctccagtccaaaataagttcaagtgtaatatttttttttcctatgggattggagaacctagtcaatatattgctgcagaaaattttccatcacagttttggaaaaa...
position 708
XM_015767827.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group uncharacterized LOC4346684 (LOC4346684), mRNA. (1328 bp)
gcctcctcgccgccgtcgcgacctcccccaagtgagacgtcacggcacggcaccgcacggtgggcaggtgtgaatacggtttattagtcttccaggtgggccccacctgtcagtgggggaaataagggtgatggccatttgggagggttggtgtggtgtggtggtgatggggagattgattgatttagctggtgggatttgcaatatttaggaagaaaattaatcaaagtgatttaaaaaatttggaggatgtagggggcaatgatttagctgttgcactgcatcagaaattcgcaagaagagattggagatttttcacatcggttgatggtgatcacacattggggatgatgatgatgatgatgatctattcatgtatgtacaattaattactagcttttgtaccaccattaattctttgattcatgttgtggtgatcaacaacaacagagatgagaatgataaaatgggaaaagcatcattaccactctttttctagtctttccagtccattttgtcatatgccccctacacattcttcgattttaacttaa
position 1069
XM_015795982.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group aspartic proteinase-like (LOC4337744), mRNA. (2009 bp)
ttccccactctctcttcttcttgggaggctgggagctaccagcacaacacaccaaggaagctgaggtgagaacgattgattactttgctggctgctcttagctactactacaactgttttgtcttaatcggttgattacatctcatatttcatcggtttagctcgctctgtgcgttgatttcttgatatcatggccaagaggcacctcttgttggtgacaacttgtttgtgggctctgtcatgtgccttgctgcttcatgcttcctctgatgggttcctgagagtcaacctcaacaagaagagattggacaaggaagatctcactgccgccaagttggcgcagcagggcaaccgtcttctgaagaccggcagttcagacagtgatcctgtccctctggtggactacctcaacacccagtactatggggtgattggcctcggctcaccgccgcagaacttcacggtgatatttgacactggaagctccaacctgtgggttccttcagcaaaatgctatttttcgatagcatgctacctccacagcagatacaactcgaaaaagtcgagctcttacaaagcagatggagaaacttgcaaaat...
position 362
XM_026025509.1 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group protein NETWORKED 2A (LOC4327456), transcript variant X5, mRNA. (2828 bp)
gcagacctatacttcaagagcaggcccgatcttataaaccatgtagaggagacatatagatcttaccaggcgcttgctgatagatatgaccgggtatcaggggagcttcacaagtccaaccacaccatagcaactgcatttccggagcaagtccagctctctctgcaagatgacaatggtgatggtttcccaaaaggtatcacagggattaatatcaacagaggaaccagcgcagctccaaagaggacgcaaacacataaaaagatcagctctaagatgagtaaagacaaggcacaagaagagattgagaggctacagaagaaaatccttgtcttgcagactgaaaaggaattcttcaagagctcatatgaatcttcgctgaacaagtatttgagcattgaaagacaggcggcagagatgcaagaggaggtatggagcttgcaggagacttttagcaccagcgcagttattgaagacaatgaagctcgagctttaatggctgcacaagcccttatttcttgcgaggataaattggctagcttgcattgtgagcaaaagagatcatatgaagagacaaccatggagattcaaagagtcata...
position 474
XM_015768273.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group protein NETWORKED 2A (LOC4327456), transcript variant X4, mRNA. (2981 bp)
gcagacctatacttcaagagcaggcccgatcttataaaccatgtagaggagacatatagatcttaccaggcgcttgctgatagatatgaccgggtatcaggggagcttcacaagtccaaccacaccatagcaactgcatttccggagcaagtccagctctctctgcaagatgacaatggtgatggtttcccaaaaggtatcacagggattaatatcaacagaggaaccagcgcagctccaaagaggacgcaaacacataaaaagatcagctctaagatgagtaaagacaaggcacaagaagagattgagaggctacagaagaaaatccttgtcttgcagactgaaaaggaattcttcaagagctcatatgaatcttcgctgaacaagtatttgagcattgaaagacaggcggcagagatgcaagaggaggtatggagcttgcaggagacttttagcaccagcgcagttattgaagacaatgaagctcgagctttaatggctgcacaagcccttatttcttgcgaggataaattggctagcttgcattgtgagcaaaagagatcatatgaagagacaaccatggagattcaaagagtcata...
position 745
XM_015768261.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group protein NETWORKED 2A (LOC4327456), transcript variant X1, mRNA. (3146 bp)
gcagacctatacttcaagagcaggcccgatcttataaaccatgtagaggagacatatagatcttaccaggcgcttgctgatagatatgaccgggtatcaggggagcttcacaagtccaaccacaccatagcaactgcatttccggagcaagtccagctctctctgcaagatgacaatggtgatggtttcccaaaaggtatcacagggattaatatcaacagaggaaccagcgcagctccaaagaggacgcaaacacataaaaagatcagctctaagatgagtaaagacaaggcacaagaagagattgagaggctacagaagaaaatccttgtcttgcagactgaaaaggaattcttcaagagctcatatgaatcttcgctgaacaagtatttgagcattgaaagacaggcggcagagatgcaagaggaggtatggagcttgcaggagacttttagcaccagcgcagttattgaagacaatgaagctcgagctttaatggctgcacaagcccttatttcttgcgaggataaattggctagcttgcattgtgagcaaaagagatcatatgaagagacaaccatggagattcaaagagtcata...
position 792
XM_015768253.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group protein NETWORKED 2A (LOC4327456), transcript variant X3, misc_RNA. (3765 bp)
gcagacctatacttcaagagcaggcccgatcttataaaccatgtagaggagacatatagatcttaccaggcgcttgctgatagatatgaccgggtatcaggggagcttcacaagtccaaccacaccatagcaactgcatttccggagcaagtccagctctctctgcaagatgacaatggtgatggtttcccaaaaggtatcacagggattaatatcaacagaggaaccagcgcagctccaaagaggacgcaaacacataaaaagatcagctctaagatgagtaaagacaaggcacaagaagagattgagaggctacagaagaaaatccttgtcttgcagactgaaaaggaattcttcaagagctcatatgaatcttcgctgaacaagtatttgagcattgaaagacaggcggcagagatgcaagaggaggtatggagcttgcaggagacttttagcaccagcgcagttattgaagacaatgaagctcgagctttaatggctgcacaagcccttatttcttgcgaggataaattggctagcttgcattgtgagcaaaagagatcatatgaagagacaaccatggagattcaaagagtcata...
position 745
XR_001542944.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group pentatricopeptide repeat-containing protein At1g03100, mitochondrial (LOC9269715), transcript variant X6, mRNA. (3912 bp)
agctgcacttctgaaagacgctcaacaagcaggtattcagcttgatccaagctgctatgaggatttgatacaatccagagcacatcacaataataccacaggtgctctcaatctttttaaagagttgaagagtttgaatattttgaaagctggtcagaatgaatttgagatgttagtacaaggctgcaataacaatggagctgctttgacaactaagctagtggaggaagtcagaagtggccacccggttaatcatgctattcatgactggaataatgttatccatttcttctgcaagaagagattgatgcatgatgctcacaaagcacttggcaagatgaaagctttaggacacacgccaaatgcacagacattccattctttagtaactggttatgctgctgttggtggtaaatatgtagaggtgacagatttgtggggtgaaatgaaagttttggccacctcaagttcaatgaattttgatcaagagctcctggactctctgctgtattgctttgtgagaggcggtttcttccttcgagccatggaagttatagaaatgatggaaaaaggcaagatgtttatagacaaatacaagta...
position 2003
XM_026020801.1 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group pentatricopeptide repeat-containing protein At1g03100, mitochondrial (LOC9269715), transcript variant X2, mRNA. (4042 bp)
agctgcacttctgaaagacgctcaacaagcaggtattcagcttgatccaagctgctatgaggatttgatacaatccagagcacatcacaataataccacaggtgctctcaatctttttaaagagttgaagagtttgaatattttgaaagctggtcagaatgaatttgagatgttagtacaaggctgcaataacaatggagctgctttgacaactaagctagtggaggaagtcagaagtggccacccggttaatcatgctattcatgactggaataatgttatccatttcttctgcaagaagagattgatgcatgatgctcacaaagcacttggcaagatgaaagctttaggacacacgccaaatgcacagacattccattctttagtaactggttatgctgctgttggtggtaaatatgtagaggtgacagatttgtggggtgaaatgaaagttttggccacctcaagttcaatgaattttgatcaagagctcctggactctctgctgtattgctttgtgagaggcggtttcttccttcgagccatggaagttatagaaatgatggaaaaaggcaagatgtttatagacaaatacaagta...
position 2003
XM_026020798.1 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group pentatricopeptide repeat-containing protein At1g03100, mitochondrial (LOC9269715), transcript variant X5, mRNA. (4055 bp)
agctgcacttctgaaagacgctcaacaagcaggtattcagcttgatccaagctgctatgaggatttgatacaatccagagcacatcacaataataccacaggtgctctcaatctttttaaagagttgaagagtttgaatattttgaaagctggtcagaatgaatttgagatgttagtacaaggctgcaataacaatggagctgctttgacaactaagctagtggaggaagtcagaagtggccacccggttaatcatgctattcatgactggaataatgttatccatttcttctgcaagaagagattgatgcatgatgctcacaaagcacttggcaagatgaaagctttaggacacacgccaaatgcacagacattccattctttagtaactggttatgctgctgttggtggtaaatatgtagaggtgacagatttgtggggtgaaatgaaagttttggccacctcaagttcaatgaattttgatcaagagctcctggactctctgctgtattgctttgtgagaggcggtttcttccttcgagccatggaagttatagaaatgatggaaaaaggcaagatgtttatagacaaatacaagta...
position 2003
XM_026020800.1 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group pentatricopeptide repeat-containing protein At1g03100, mitochondrial (LOC9269715), transcript variant X3, mRNA. (4100 bp)
agctgcacttctgaaagacgctcaacaagcaggtattcagcttgatccaagctgctatgaggatttgatacaatccagagcacatcacaataataccacaggtgctctcaatctttttaaagagttgaagagtttgaatattttgaaagctggtcagaatgaatttgagatgttagtacaaggctgcaataacaatggagctgctttgacaactaagctagtggaggaagtcagaagtggccacccggttaatcatgctattcatgactggaataatgttatccatttcttctgcaagaagagattgatgcatgatgctcacaaagcacttggcaagatgaaagctttaggacacacgccaaatgcacagacattccattctttagtaactggttatgctgctgttggtggtaaatatgtagaggtgacagatttgtggggtgaaatgaaagttttggccacctcaagttcaatgaattttgatcaagagctcctggactctctgctgtattgctttgtgagaggcggtttcttccttcgagccatggaagttatagaaatgatggaaaaaggcaagatgtttatagacaaatacaagta...
position 2003
XM_015759312.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group pentatricopeptide repeat-containing protein At1g03100, mitochondrial (LOC9269715), transcript variant X1, mRNA. (4187 bp)
agctgcacttctgaaagacgctcaacaagcaggtattcagcttgatccaagctgctatgaggatttgatacaatccagagcacatcacaataataccacaggtgctctcaatctttttaaagagttgaagagtttgaatattttgaaagctggtcagaatgaatttgagatgttagtacaaggctgcaataacaatggagctgctttgacaactaagctagtggaggaagtcagaagtggccacccggttaatcatgctattcatgactggaataatgttatccatttcttctgcaagaagagattgatgcatgatgctcacaaagcacttggcaagatgaaagctttaggacacacgccaaatgcacagacattccattctttagtaactggttatgctgctgttggtggtaaatatgtagaggtgacagatttgtggggtgaaatgaaagttttggccacctcaagttcaatgaattttgatcaagagctcctggactctctgctgtattgctttgtgagaggcggtttcttccttcgagccatggaagttatagaaatgatggaaaaaggcaagatgtttatagacaaatacaagta...
position 2003
XM_015759311.2 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group pentatricopeptide repeat-containing protein At1g03100, mitochondrial (LOC9269715), transcript variant X4, mRNA. (4625 bp)
agctgcacttctgaaagacgctcaacaagcaggtattcagcttgatccaagctgctatgaggatttgatacaatccagagcacatcacaataataccacaggtgctctcaatctttttaaagagttgaagagtttgaatattttgaaagctggtcagaatgaatttgagatgttagtacaaggctgcaataacaatggagctgctttgacaactaagctagtggaggaagtcagaagtggccacccggttaatcatgctattcatgactggaataatgttatccatttcttctgcaagaagagattgatgcatgatgctcacaaagcacttggcaagatgaaagctttaggacacacgccaaatgcacagacattccattctttagtaactggttatgctgctgttggtggtaaatatgtagaggtgacagatttgtggggtgaaatgaaagttttggccacctcaagttcaatgaattttgatcaagagctcctggactctctgctgtattgctttgtgagaggcggtttcttccttcgagccatggaagttatagaaatgatggaaaaaggcaagatgtttatagacaaatacaagta...
position 2003
XM_026020799.1 - Oryza sativa Japonica Group (Japanese rice) - NCBI
PREDICTED: Oryza sativa Japonica Group protein NETWORKED 2A (LOC4327456), transcript variant X2, misc_RNA. (4956 bp)
gcagacctatacttcaagagcaggcccgatcttataaaccatgtagaggagacatatagatcttaccaggcgcttgctgatagatatgaccgggtatcaggggagcttcacaagtccaaccacaccatagcaactgcatttccggagcaagtccagctctctctgcaagatgacaatggtgatggtttcccaaaaggtatcacagggattaatatcaacagaggaaccagcgcagctccaaagaggacgcaaacacataaaaagatcagctctaagatgagtaaagacaaggcacaagaagagattgagaggctacagaagaaaatccttgtcttgcagactgaaaaggaattcttcaagagctcatatgaatcttcgctgaacaagtatttgagcattgaaagacaggcggcagagatgcaagaggaggtatggagcttgcaggagacttttagcaccagcgcagttattgaagacaatgaagctcgagctttaatggctgcacaagcccttatttcttgcgaggataaattggctagcttgcattgtgagcaaaagagatcatatgaagagacaaccatggagattcaaagagtcata...
position 745
XR_003240207.1 - Oryza sativa Japonica Group (Japanese rice) - NCBI

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/os/caagaagagattg
lang : en | div : | spe : os | query_string : caagaagagattg | format : html | download :

0.000 | 0.000 | search_start;
0.076 | 0.076 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:caagaagagattg)?source=Oryza sativa Japonica Group (Japanese rice)?to=0&format=json
0.104 | 0.028 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:caagaagagattg)?source=Oryza sativa Japonica Group (Japanese rice)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.105 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]