GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-22 13:59:00, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_066305356            3060 bp    mRNA    linear   PLN 10-JUL-2024
DEFINITION  PREDICTED: Oryza sativa Japonica Group receptor-like protein 7
            (LOC107275840), mRNA.
ACCESSION   XM_066305356
VERSION     XM_066305356.1
DBLINK      BioProject: PRJNA1123306
KEYWORDS    RefSeq; corrected model; includes ab initio.
SOURCE      Oryza sativa Japonica Group (Japanese rice)
  ORGANISM  Oryza sativa Japonica Group
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP
            clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_089035) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_034140825.1-RS_2024_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/21/2024
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio   :: 1% of CDS bases
            frameshifts :: corrected 1 indel
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1374              CP132235.1         3184612-3185985
            1375-1375           "N"                1-1
            1376-3060           CP132235.1         3185986-3187670
FEATURES             Location/Qualifiers
     source          1..3060
                     /organism="Oryza sativa Japonica Group"
                     /mol_type="mRNA"
                     /db_xref="taxon:39947"
                     /chromosome="1"
     gene            1..3060
                     /gene="LOC107275840"
                     /note="receptor-like protein 7; The sequence of the model
                     RefSeq transcript was modified relative to its source
                     genomic sequence to represent the inferred CDS: inserted 1
                     base in 1 codon; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 6 Proteins, and 8%
                     coverage of the annotated genomic feature by RNAseq
                     alignments"
                     /db_xref="GeneID:107275840"
     CDS             1..3060
                     /gene="LOC107275840"
                     /note="The sequence of the model RefSeq protein was
                     modified relative to its source genomic sequence to
                     represent the inferred CDS: inserted 1 base in 1 codon"
                     /codon_start=1
                     /product="LOW QUALITY PROTEIN: receptor-like protein 7"
                     /protein_id="XP_066161453.1"
                     /db_xref="GeneID:107275840"
                     /translation="
MSSIILTQTPSVPRRLLLLLQLSFLLLLSSASNAVTPAGVPCRPDQAAALLRLKRSFAVTSNSVTAFRSWRAGTDCCGWEGVGCAAGAGANNGRAVTSLHLGDWGLESAGIDPALFELTSLEYLNLAYNNFGGSKIPSDGFERLIRLTHLNLSSSGFTGQVPASIGNLTSLVSLDLSTYFMIVEIPDDAYETLISQTANSIWLIEPNFETFISKLTNLRDLHLGYVDMSNSGAQWCDALANSSPNLQVISLPFCSISGPICRSLSLLQSLAALNLQHNNLSGPIPDFLSNLSNLSVLRLNHNELEGWVSPAIFGQKNLVTIDLHHNLGISGILPNFSADSRLEELLVGQTNCSGLIPSSIGNLKFLKQLDLGASGFFGELPSSIGKLESLNALGISGVGLEGPLPSWVANLTSLTALVFSDCGLSGSIPSFIGDLKELRTLALCNCKFSGEIPPHIFNXTQMELLLLHFNNFTGTIELTSLSNLPQLYAFDLSYNNLAVVDGEYNSSVSLPQIVLLYLPGCSMSKFPIFLRHQYEINGLDLSDNEINGTIPHWAWETWNYISLLGLSGNRFTSVGYDPLLPLQVDLLDLSNNMLEGSIPIPRGSSTSLKYSNNGFSSMPSNFSAHLRDVTFFMADGNEISGNIPLEFCSAKSLQLLDLSYNNFNGSISSCLMDSVSTLQVLNLKGNELHGVLPDDIKEGCSFQALDISGNLIEGKLPRSLVACKNLEVFDVGFNQISDTFPCWMSTLPRLQVIALRSNKFFGQVAQSAVEKNSCEFPAARIIDLASNNFSGPLPQDQWFKKLKSMMIGYSNTSLVMDHEVPRVGRYKFSTTITYKGSAVTLTKILRTFVFIDVSENKFHGSIPGTIGELILLHALNMSHNFLTGPIPSQLGHLNQLEALDMSSNELSGVIPQELASLDFLAILNLSYNKLEGRIPPQSPHFSTFSSISFLGNKGLCGLPLSTGCSNTTSLNVIPSEKNPVDIVLFLSAGLGFGLGFAIAIVVAWGIPIRKRSTVRQRAL"
     misc_feature    286..360
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    <292..>1218
                     /gene="LOC107275840"
                     /note="leucine-rich repeat receptor-like protein kinase;
                     Provisional; Region: PLN00113"
                     /db_xref="CDD:215061"
     misc_feature    361..438
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    439..510
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    511..585
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    652..735
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    820..879
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    865..>2889
                     /gene="LOC107275840"
                     /note="leucine-rich repeat receptor-like protein kinase;
                     Provisional; Region: PLN00113"
                     /db_xref="CDD:215061"
     misc_feature    880..951
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    952..1023
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    1024..1095
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    1096..1167
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    1168..1239
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    1240..1311
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    1312..1383
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    1384..1458
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    1537..1605
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    1615..1686
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    1687..1749
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    1822..1884
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    1885..1956
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    1957..2031
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    2032..2103
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    2104..2175
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    2176..2247
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    2248..2334
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    2335..2412
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    2533..2613
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    2614..2685
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
     misc_feature    2686..2757
                     /gene="LOC107275840"
                     /note="leucine-rich repeat [structural motif]; Region:
                     leucine-rich repeat"
                     /db_xref="CDD:275380"
ORIGIN      
atgtcctccattattcttactcagacaccatcagtaccacgacgcctactgctcctcctacagctctcgtttctgctcctcctcagctccgccagcaatgctgtcacgccggctggggtgccatgccggccagaccaggcggccgcgttgctccggctgaaacgctcattcgccgtcaccagcaactccgtcaccgccttccggtcatggcgggccggcaccgactgctgcggctgggagggcgttggctgcgccgccggcgccggcgccaacaatggccgcgccgtgacatcccttcatctgggtgactggggcttggagagtgcaggcatcgaccctgcactcttcgagctaacctctctggagtatctaaacctcgcctataacaacttcggtgggtcaaagattccttctgatggatttgagcgtctcatcaggctcacacatctgaatctttccagctctggattcaccggacaggtgccagccagcatcggcaacctgacgagtttggtatcactcgacctttccacttatttcatgatcgtggagatacccgatgatgcttatgagacgcttatatctcaaactgctaattccatatggctcatagagccaaattttgaaacctttatctcaaaactcacaaacttgagggatctccacctcggctatgtggacatgtccaacagtggagcgcagtggtgtgatgctctagccaattcctctcctaatcttcaggttattagcttaccattctgttcaatctctggccctatctgccgctcactttcccttttgcagtctcttgctgcccttaacttgcaacataacaatctgtctggtccaatcccagacttcttgtcaaacttatccaatttgagtgttctccgacttaaccataatgagcttgaaggatgggtttctccggcaatctttggacaaaagaatcttgtcacaattgatctccaccataatcttgggatctctggtattctcccaaatttctcagctgacagtaggctggaggaattgctcgttggccagactaattgctcgggtttaataccaagttccattggaaatctcaaatttttgaagcagctagacctcggtgcgtctggtttttttggagagctgccctcatcaattggtaagctagaatccttgaatgcattggggatatccggagtgggactagaagggccattaccatcatgggttgcaaacttaacctctttgacggctcttgtgttctctgattgtgggttatccggatcgataccttctttcataggagatttgaaggaattgagaacattagcgttgtgtaactgcaaattttccggtgaaataccaccacacatatttaatnctactcaaatggaattactcttgctccattttaacaatttcaccggcacaatagagctgacttcattaagtaatctgccacaactttatgcctttgatctctcctataataatctagctgtggtcgatggagaatataactcatcagtttctcttccccaaattgtgctcctatatttaccgggttgcagcatgtctaagttccctattttcttgaggcaccaatatgaaattaatggcctcgacctttccgacaacgaaattaacggtactataccgcattgggcatgggaaacttggaattatatttcccttttgggcctatccggcaatagatttacgagtgtgggatatgaccctcttcttcccttacaagtagatttgcttgatcttagcaataacatgcttgaagggtccattccgattcctcgaggctcttcaacatctctcaaatattcaaacaatgggttctcatccatgccatctaattttagtgctcatcttagagatgttacctttttcatggccgacggaaatgaaatctctggaaatattcctttggagttttgcagtgctaagagtttacaactccttgatctgtcttacaacaacttcaatggatcaatctcttcttgtttaatggacagtgttagcacgctgcaagtattaaatctgaaaggaaatgaacttcatggggtgttgccagacgatatcaaagaaggctgttcatttcaggcattagatattagcggaaatttgatagaggggaaactaccaagatcattagttgcttgcaaaaacttggaggtatttgatgttgggttcaatcaaattagtgacacctttccatgttggatgagtactcttccgagacttcaagtcattgccctcagatctaacaagttcttcggacaggtcgcacaatctgctgtagagaaaaattcttgtgaatttccagctgcaagaattattgatctagcctcaaacaacttctcgggtccattgccacaagatcaatggtttaagaaattgaagtccatgatgatcggatactcgaatacgtcattagtcatggatcatgaagtaccacgagtaggaaggtacaaattcagtactacgatcacatataaagggagcgccgtcacattgaccaagattttgaggacatttgtattcatcgatgtctcagaaaacaaattccatgggagcattccagggaccattggagaacttattctgttacacgcactcaacatgtcacacaacttcttgacaggaccgattccatctcaactcggccatttgaaccagttggaggctttggacatgtcctcaaatgagctttcaggagtaattcctcaggagctagcatccttggacttccttgcaatattgaacctgtcatacaataagctagagggaagaataccaccacagtcacctcatttctctacattctccagcatctcatttctggggaacaagggtttgtgcggccttcctctgtcgacaggatgcagcaacacgacatctctgaatgtgatcccttctgagaagaatcctgtagacatcgtgctattcctttctgctggactgggattcggccttggatttgccattgcaattgtagtagcatggggaattcccattaggaaacggtccacagtaaggcagagagctctctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]