ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-22 13:59:00, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_066305356 3060 bp mRNA linear PLN 10-JUL-2024
DEFINITION PREDICTED: Oryza sativa Japonica Group receptor-like protein 7
(LOC107275840), mRNA.
ACCESSION XM_066305356
VERSION XM_066305356.1
DBLINK BioProject: PRJNA1123306
KEYWORDS RefSeq; corrected model; includes ab initio.
SOURCE Oryza sativa Japonica Group (Japanese rice)
ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP
clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_089035) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Full annotation
Annotation Name :: GCF_034140825.1-RS_2024_06
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.3
Annotation Method :: Best-placed RefSeq; Gnomon;
cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 06/21/2024
##Genome-Annotation-Data-END##
##RefSeq-Attributes-START##
ab initio :: 1% of CDS bases
frameshifts :: corrected 1 indel
##RefSeq-Attributes-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-1374 CP132235.1 3184612-3185985
1375-1375 "N" 1-1
1376-3060 CP132235.1 3185986-3187670
FEATURES Location/Qualifiers
source 1..3060
/organism="Oryza sativa Japonica Group"
/mol_type="mRNA"
/db_xref="taxon:39947"
/chromosome="1"
gene 1..3060
/gene="LOC107275840"
/note="receptor-like protein 7; The sequence of the model
RefSeq transcript was modified relative to its source
genomic sequence to represent the inferred CDS: inserted 1
base in 1 codon; Derived by automated computational
analysis using gene prediction method: Gnomon. Supporting
evidence includes similarity to: 6 Proteins, and 8%
coverage of the annotated genomic feature by RNAseq
alignments"
/db_xref="GeneID:107275840"
CDS 1..3060
/gene="LOC107275840"
/note="The sequence of the model RefSeq protein was
modified relative to its source genomic sequence to
represent the inferred CDS: inserted 1 base in 1 codon"
/codon_start=1
/product="LOW QUALITY PROTEIN: receptor-like protein 7"
/protein_id="XP_066161453.1"
/db_xref="GeneID:107275840"
/translation="
MSSIILTQTPSVPRRLLLLLQLSFLLLLSSASNAVTPAGVPCRPDQAAALLRLKRSFAVTSNSVTAFRSWRAGTDCCGWEGVGCAAGAGANNGRAVTSLHLGDWGLESAGIDPALFELTSLEYLNLAYNNFGGSKIPSDGFERLIRLTHLNLSSSGFTGQVPASIGNLTSLVSLDLSTYFMIVEIPDDAYETLISQTANSIWLIEPNFETFISKLTNLRDLHLGYVDMSNSGAQWCDALANSSPNLQVISLPFCSISGPICRSLSLLQSLAALNLQHNNLSGPIPDFLSNLSNLSVLRLNHNELEGWVSPAIFGQKNLVTIDLHHNLGISGILPNFSADSRLEELLVGQTNCSGLIPSSIGNLKFLKQLDLGASGFFGELPSSIGKLESLNALGISGVGLEGPLPSWVANLTSLTALVFSDCGLSGSIPSFIGDLKELRTLALCNCKFSGEIPPHIFNXTQMELLLLHFNNFTGTIELTSLSNLPQLYAFDLSYNNLAVVDGEYNSSVSLPQIVLLYLPGCSMSKFPIFLRHQYEINGLDLSDNEINGTIPHWAWETWNYISLLGLSGNRFTSVGYDPLLPLQVDLLDLSNNMLEGSIPIPRGSSTSLKYSNNGFSSMPSNFSAHLRDVTFFMADGNEISGNIPLEFCSAKSLQLLDLSYNNFNGSISSCLMDSVSTLQVLNLKGNELHGVLPDDIKEGCSFQALDISGNLIEGKLPRSLVACKNLEVFDVGFNQISDTFPCWMSTLPRLQVIALRSNKFFGQVAQSAVEKNSCEFPAARIIDLASNNFSGPLPQDQWFKKLKSMMIGYSNTSLVMDHEVPRVGRYKFSTTITYKGSAVTLTKILRTFVFIDVSENKFHGSIPGTIGELILLHALNMSHNFLTGPIPSQLGHLNQLEALDMSSNELSGVIPQELASLDFLAILNLSYNKLEGRIPPQSPHFSTFSSISFLGNKGLCGLPLSTGCSNTTSLNVIPSEKNPVDIVLFLSAGLGFGLGFAIAIVVAWGIPIRKRSTVRQRAL"
misc_feature 286..360
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature <292..>1218
/gene="LOC107275840"
/note="leucine-rich repeat receptor-like protein kinase;
Provisional; Region: PLN00113"
/db_xref="CDD:215061"
misc_feature 361..438
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 439..510
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 511..585
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 652..735
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 820..879
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 865..>2889
/gene="LOC107275840"
/note="leucine-rich repeat receptor-like protein kinase;
Provisional; Region: PLN00113"
/db_xref="CDD:215061"
misc_feature 880..951
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 952..1023
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 1024..1095
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 1096..1167
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 1168..1239
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 1240..1311
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 1312..1383
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 1384..1458
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 1537..1605
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 1615..1686
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 1687..1749
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 1822..1884
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 1885..1956
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 1957..2031
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 2032..2103
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 2104..2175
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 2176..2247
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 2248..2334
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 2335..2412
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 2533..2613
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 2614..2685
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
misc_feature 2686..2757
/gene="LOC107275840"
/note="leucine-rich repeat [structural motif]; Region:
leucine-rich repeat"
/db_xref="CDD:275380"
ORIGIN
atgtcctccattattcttactcagacaccatcagtaccacgacgcctactgctcctcctacagctctcgtttctgctcctcctcagctccgccagcaatgctgtcacgccggctggggtgccatgccggccagaccaggcggccgcgttgctccggctgaaacgctcattcgccgtcaccagcaactccgtcaccgccttccggtcatggcgggccggcaccgactgctgcggctgggagggcgttggctgcgccgccggcgccggcgccaacaatggccgcgccgtgacatcccttcatctgggtgactggggcttggagagtgcaggcatcgaccctgcactcttcgagctaacctctctggagtatctaaacctcgcctataacaacttcggtgggtcaaagattccttctgatggatttgagcgtctcatcaggctcacacatctgaatctttccagctctggattcaccggacaggtgccagccagcatcggcaacctgacgagtttggtatcactcgacctttccacttatttcatgatcgtggagatacccgatgatgcttatgagacgcttatatctcaaactgctaattccatatggctcatagagccaaattttgaaacctttatctcaaaactcacaaacttgagggatctccacctcggctatgtggacatgtccaacagtggagcgcagtggtgtgatgctctagccaattcctctcctaatcttcaggttattagcttaccattctgttcaatctctggccctatctgccgctcactttcccttttgcagtctcttgctgcccttaacttgcaacataacaatctgtctggtccaatcccagacttcttgtcaaacttatccaatttgagtgttctccgacttaaccataatgagcttgaaggatgggtttctccggcaatctttggacaaaagaatcttgtcacaattgatctccaccataatcttgggatctctggtattctcccaaatttctcagctgacagtaggctggaggaattgctcgttggccagactaattgctcgggtttaataccaagttccattggaaatctcaaatttttgaagcagctagacctcggtgcgtctggtttttttggagagctgccctcatcaattggtaagctagaatccttgaatgcattggggatatccggagtgggactagaagggccattaccatcatgggttgcaaacttaacctctttgacggctcttgtgttctctgattgtgggttatccggatcgataccttctttcataggagatttgaaggaattgagaacattagcgttgtgtaactgcaaattttccggtgaaataccaccacacatatttaatnctactcaaatggaattactcttgctccattttaacaatttcaccggcacaatagagctgacttcattaagtaatctgccacaactttatgcctttgatctctcctataataatctagctgtggtcgatggagaatataactcatcagtttctcttccccaaattgtgctcctatatttaccgggttgcagcatgtctaagttccctattttcttgaggcaccaatatgaaattaatggcctcgacctttccgacaacgaaattaacggtactataccgcattgggcatgggaaacttggaattatatttcccttttgggcctatccggcaatagatttacgagtgtgggatatgaccctcttcttcccttacaagtagatttgcttgatcttagcaataacatgcttgaagggtccattccgattcctcgaggctcttcaacatctctcaaatattcaaacaatgggttctcatccatgccatctaattttagtgctcatcttagagatgttacctttttcatggccgacggaaatgaaatctctggaaatattcctttggagttttgcagtgctaagagtttacaactccttgatctgtcttacaacaacttcaatggatcaatctcttcttgtttaatggacagtgttagcacgctgcaagtattaaatctgaaaggaaatgaacttcatggggtgttgccagacgatatcaaagaaggctgttcatttcaggcattagatattagcggaaatttgatagaggggaaactaccaagatcattagttgcttgcaaaaacttggaggtatttgatgttgggttcaatcaaattagtgacacctttccatgttggatgagtactcttccgagacttcaagtcattgccctcagatctaacaagttcttcggacaggtcgcacaatctgctgtagagaaaaattcttgtgaatttccagctgcaagaattattgatctagcctcaaacaacttctcgggtccattgccacaagatcaatggtttaagaaattgaagtccatgatgatcggatactcgaatacgtcattagtcatggatcatgaagtaccacgagtaggaaggtacaaattcagtactacgatcacatataaagggagcgccgtcacattgaccaagattttgaggacatttgtattcatcgatgtctcagaaaacaaattccatgggagcattccagggaccattggagaacttattctgttacacgcactcaacatgtcacacaacttcttgacaggaccgattccatctcaactcggccatttgaaccagttggaggctttggacatgtcctcaaatgagctttcaggagtaattcctcaggagctagcatccttggacttccttgcaatattgaacctgtcatacaataagctagagggaagaataccaccacagtcacctcatttctctacattctccagcatctcatttctggggaacaagggtttgtgcggccttcctctgtcgacaggatgcagcaacacgacatctctgaatgtgatcccttctgagaagaatcctgtagacatcgtgctattcctttctgctggactgggattcggccttggatttgccattgcaattgtagtagcatggggaattcccattaggaaacggtccacagtaaggcagagagctctctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]