2024-04-19 17:03:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_026027438 1042 bp mRNA linear PLN 07-AUG-2018 DEFINITION PREDICTED: Oryza sativa Japonica Group homeobox-leucine zipper protein HOX3 (LOC4326566), transcript variant X2, mRNA. ACCESSION XM_026027438 VERSION XM_026027438.1 DBLINK BioProject: PRJNA122 KEYWORDS RefSeq. SOURCE Oryza sativa Japonica Group (Japanese rice) ORGANISM Oryza sativa Japonica Group Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_029256.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Oryza sativa Japonica Group Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1042 /organism="Oryza sativa Japonica Group" /mol_type="mRNA" /cultivar="Nipponbare" /db_xref="taxon:39947" /chromosome="1" gene 1..1042 /gene="LOC4326566" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 6 samples with support for all annotated introns" /db_xref="GeneID:4326566" CDS 247..819 /gene="LOC4326566" /codon_start=1 /product="homeobox-leucine zipper protein HOX3 isoform X2" /protein_id="XP_025883223.1" /db_xref="GeneID:4326566" /translation="
MRDLDINQPASGGEEEEFPMGSVEEDEEERGVGGPHRPKKLRLSKEQSRLLEESFRLNHTLTPKQKEALAIKLKLRPRQVEVWFQNRRARTKLKQTEMECEYLKRCFGSLTEENRRLQREVEELRAMRVAPPTVLSPHTRQPLPASALTMCPRCERITAATGPPAVRPPPSSAAAAAPSPFHPRRPSAAF"
misc_feature order(355..369,373..375,424..426,442..444,481..483, 487..492,499..504,508..516,520..525) /gene="LOC4326566" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 355..522 /gene="LOC4326566" /note="Homeodomain; Region: HOX; smart00389" /db_xref="CDD:197696" misc_feature order(361..363,370..372,490..492,499..504,511..513) /gene="LOC4326566" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 526..657 /gene="LOC4326566" /note="homeobox associated leucin zipper; Region: HALZ; smart00340" /db_xref="CDD:128634" ORIGIN
aaccaatctcctagctatgtctccatcctacaaacgtgcgtgccttgatcttttttttttcgtcggaacatgcccatatgtgagagcgcacctccaaccttttgaagttggagttaccaacacatatatgcatggtcttcagaatgtttttctcggcatggagactgaacttgtttgcggttttcattgacgtttgcttctgaaggggccggttgcaacaacaacaacgccggtggcggctgcaacatgagggacctggacatcaaccagccggcgagcggcggcgaggaggaggagttcccgatgggcagcgtggaggaggacgaggaggagaggggcgtcggtgggccccaccgccccaagaagctccgcctctccaaggagcagtcccgcctcctcgaggagagcttccgcctcaaccataccctcacgccgaagcaaaaggaggccttggcgatcaaactgaagctgcggccgaggcaggtggaggtctggtttcagaaccgtagggcaaggacgaagctgaagcagacggagatggagtgcgagtacctgaagcgctgcttcgggtcgctgacggaggagaaccgccggctgcagcgggaggtggaggagctgcgggcgatgcgggtggccccgcccacggtgctctcgccgcacaccaggcagccgctcccggcgtccgcgctcaccatgtgcccccgctgcgagcgcatcaccgccgccaccggcccgcctgccgtgcgcccgccgccgtcgtcagccgccgccgccgccccctcgcccttccaccctcgccgcccctctgcggccttctaggcccaaggtctcgcatcctaaaggccacaaaaagatgggcctcgccgtcccgtgtaaattgaaggagacgacgcagcggtagagggccccgtgttggcgttgttgcgttgggtccagtcgtctcagaggagtcagaggcgtggacaaaatgtttgttgcattgtttgtgttccattggtcgttgatcttagcttgatgatctgtgattcgcgccttgctcgtc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]