GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-19 17:03:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_026027438            1042 bp    mRNA    linear   PLN 07-AUG-2018
DEFINITION  PREDICTED: Oryza sativa Japonica Group homeobox-leucine zipper
            protein HOX3 (LOC4326566), transcript variant X2, mRNA.
ACCESSION   XM_026027438
VERSION     XM_026027438.1
DBLINK      BioProject: PRJNA122
KEYWORDS    RefSeq.
SOURCE      Oryza sativa Japonica Group (Japanese rice)
  ORGANISM  Oryza sativa Japonica Group
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP
            clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_029256.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Oryza sativa Japonica Group
                                           Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1042
                     /organism="Oryza sativa Japonica Group"
                     /mol_type="mRNA"
                     /cultivar="Nipponbare"
                     /db_xref="taxon:39947"
                     /chromosome="1"
     gene            1..1042
                     /gene="LOC4326566"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 6 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:4326566"
     CDS             247..819
                     /gene="LOC4326566"
                     /codon_start=1
                     /product="homeobox-leucine zipper protein HOX3 isoform X2"
                     /protein_id="XP_025883223.1"
                     /db_xref="GeneID:4326566"
                     /translation="
MRDLDINQPASGGEEEEFPMGSVEEDEEERGVGGPHRPKKLRLSKEQSRLLEESFRLNHTLTPKQKEALAIKLKLRPRQVEVWFQNRRARTKLKQTEMECEYLKRCFGSLTEENRRLQREVEELRAMRVAPPTVLSPHTRQPLPASALTMCPRCERITAATGPPAVRPPPSSAAAAAPSPFHPRRPSAAF"
     misc_feature    order(355..369,373..375,424..426,442..444,481..483,
                     487..492,499..504,508..516,520..525)
                     /gene="LOC4326566"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    355..522
                     /gene="LOC4326566"
                     /note="Homeodomain; Region: HOX; smart00389"
                     /db_xref="CDD:197696"
     misc_feature    order(361..363,370..372,490..492,499..504,511..513)
                     /gene="LOC4326566"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    526..657
                     /gene="LOC4326566"
                     /note="homeobox associated leucin zipper; Region: HALZ;
                     smart00340"
                     /db_xref="CDD:128634"
ORIGIN      
aaccaatctcctagctatgtctccatcctacaaacgtgcgtgccttgatcttttttttttcgtcggaacatgcccatatgtgagagcgcacctccaaccttttgaagttggagttaccaacacatatatgcatggtcttcagaatgtttttctcggcatggagactgaacttgtttgcggttttcattgacgtttgcttctgaaggggccggttgcaacaacaacaacgccggtggcggctgcaacatgagggacctggacatcaaccagccggcgagcggcggcgaggaggaggagttcccgatgggcagcgtggaggaggacgaggaggagaggggcgtcggtgggccccaccgccccaagaagctccgcctctccaaggagcagtcccgcctcctcgaggagagcttccgcctcaaccataccctcacgccgaagcaaaaggaggccttggcgatcaaactgaagctgcggccgaggcaggtggaggtctggtttcagaaccgtagggcaaggacgaagctgaagcagacggagatggagtgcgagtacctgaagcgctgcttcgggtcgctgacggaggagaaccgccggctgcagcgggaggtggaggagctgcgggcgatgcgggtggccccgcccacggtgctctcgccgcacaccaggcagccgctcccggcgtccgcgctcaccatgtgcccccgctgcgagcgcatcaccgccgccaccggcccgcctgccgtgcgcccgccgccgtcgtcagccgccgccgccgccccctcgcccttccaccctcgccgcccctctgcggccttctaggcccaaggtctcgcatcctaaaggccacaaaaagatgggcctcgccgtcccgtgtaaattgaaggagacgacgcagcggtagagggccccgtgttggcgttgttgcgttgggtccagtcgtctcagaggagtcagaggcgtggacaaaatgtttgttgcattgtttgtgttccattggtcgttgatcttagcttgatgatctgtgattcgcgccttgctcgtc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]