2024-04-19 20:57:07, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_026020584 3755 bp mRNA linear PLN 07-AUG-2018 DEFINITION PREDICTED: Oryza sativa Japonica Group homeobox-leucine zipper protein ROC3-like (LOC4349488), transcript variant X1, mRNA. ACCESSION XM_026020584 VERSION XM_026020584.1 DBLINK BioProject: PRJNA122 KEYWORDS RefSeq. SOURCE Oryza sativa Japonica Group (Japanese rice) ORGANISM Oryza sativa Japonica Group Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_029265.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Oryza sativa Japonica Group Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3755 /organism="Oryza sativa Japonica Group" /mol_type="mRNA" /cultivar="Nipponbare" /db_xref="taxon:39947" /chromosome="10" gene 1..3755 /gene="LOC4349488" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 11 ESTs, 11 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 5 samples with support for all annotated introns" /db_xref="GeneID:4349488" CDS 321..2969 /gene="LOC4349488" /codon_start=1 /product="homeobox-leucine zipper protein ROC3" /protein_id="XP_025876369.1" /db_xref="GeneID:4349488" /translation="
MRRMFGDCQVLSSMAAMAGAASSADALFASPLIPNPALAGFMSSSAAMPFHHFSNAAATLIPKEEGLMGGLHVAKDEGMDLEMDMELSGGSGSAHLDGLLSFADVDDDHKPQHSGHDQPPDAAQPSGAAGGNAKKKRYHRHTAHQIQQMEALFKECPHPDDKQRLKLSQELGLKPRQVKFWFQNRRTQMKAQQDRADNVILRAENENLKSDNFRLQAAIRNVVCPNCGHAAVLADMSYEEQQLRIENARLKDELDRLACIATRYGGGGGRQPVLSTSALSCISAPPPVLMPPLDLDMNVYSRHFAEQAPVMGCGDLIPPPVVPQHDGAAAYMGAMMAPVQEQDKQLVVDLAATAADQLARMCRAGEPLWVRQRGAEVMAVEEHARMFSWPVDGAKQGDGGAVARAEGTRDNAVVIMNSINLVDAFLDANKWMELFPSIVCKARTIQIINHGAASGHLGSGTLLLMQAEVQFLSPLVAAREVVFFRYCVHNADEGSWAIVDFPAEGFEEGLLQASVVRCRRRPSGCIIQDMPNGYSRVVWVEHMEMVGEEKPLQPVFRDYVASGAAFGATRWLSILQRQCERLASELARNIADLGVIRTPEARTNMMKLSQRMITTFCANISASGTQSWTALSDSTQDTIRVTTRKNTEPGQPSGVILTAVSTSWLPFTHQQVFELLADEQQRCQLEILSNGGSLHEVAHIANGSHPRNCISLLRINAASNSSQNVELLLQESSTHPDGGSLVVFATVDVDAIQVTMSGEDPSYIPLLPLGFAIFPATSPSPAAAPTISSSTTTTTGNGNGETSSTPPRNSSSNNNNADELLPPNGCLLTVGMQVLASAVPSAKLNLSSVTAINSHVCNAIHQITAALKSSAGGAGGEPASDQ"
misc_feature order(723..737,741..743,792..794,810..812,849..851, 855..860,867..872,876..884,888..893) /gene="LOC4349488" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 729..890 /gene="LOC4349488" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(729..731,738..740,858..860,867..872,879..881) /gene="LOC4349488" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 1350..2060 /gene="LOC4349488" /note="C-terminal lipid-binding START domain of the Arabidopsis homeobox protein GLABRA 2 and related proteins; Region: START_ArGLABRA2_like; cd08875" /db_xref="CDD:176884" misc_feature order(1434..1439,1464..1466,1542..1544,1548..1550, 1581..1583,1593..1595,1605..1607,1614..1619,1632..1637, 1722..1724,1728..1739,1746..1748,1755..1757,1761..1763, 1767..1769,1818..1820,1872..1874,1878..1889,1893..1895, 1929..1931,1935..1937,1941..1943,1947..1949,1953..1955, 1965..1967,1983..1985,1989..1997,2001..2009,2016..2021, 2028..2030) /gene="LOC4349488" /note="putative lipid binding site [chemical binding]; other site" /db_xref="CDD:176884" ORIGIN
caaagccatcggttactcctcttcctcgctcgctcgctcgctgccttagccttgacctccatcgatattgcaaccataaagaggaggaggaagaggaggcgagaaagagagagagatcgtcttcttctccagccagccagccagccgtgattgatctcaagggggaaggcagctgcagggatcaagaagaaggagaagaagtgatcaaggaaggaaggccacggaacaaccgacagggagggcgctggccggatcgccggagaaggaaccactagctagctagctagctactcctattgaagatatcgccggccggacatatgcgcaggatgttcggggactgccaggtcctgtcgtccatggccgccatggccggggccgcctcctccgccgacgcgctcttcgcctcgccgctcatccccaaccccgctctcgccggcttcatgtcctcctccgccgccatgcccttccaccacttctccaacgccgccgccaccttaatacctaaggaggaggggttgatgggcggcctccatgtggccaaggacgaggggatggacctcgagatggacatggagctcagtggcggctccggcagcgcccacctcgacggcctcctcagcttcgccgacgtcgacgacgaccacaagccgcagcacagcggccatgaccagccgcccgacgccgcccagcccagcggcgccgcggggggcaacgccaagaagaagcgctaccaccgccacacggcgcaccagatccagcagatggaggcgctgttcaaggagtgcccgcatccggacgacaagcagcggctgaagctgagccaggaactgggcctcaaacctcgccaggtcaagttctggttccagaatcgccggacccagatgaaggcgcagcaggacagggcggacaacgtgattctgcgcgcggagaacgagaacctcaagagcgacaacttccgcctccaggccgccatccgcaacgtcgtctgccccaactgcggccacgccgccgtcctcgccgacatgtcctacgaggagcagcagctccgcatcgagaacgccaggctcaaagacgagcttgaccgcttggcctgcatcgccacccgctacggcggcggcggcggacggcagccggtgctgtcgacgtcggccctgagctgcatctcggcgccgccgccggtcctcatgccaccgctcgacctcgacatgaacgtctactcgcggcacttcgccgagcaggcgccggtcatgggctgcggcgacctcatcccgccacccgtcgtgccgcagcacgatggcgcggcggcgtacatgggcgccatgatggcgcccgtgcaggagcaggacaagcagctggtggtcgacctcgccgccacggcggcggaccagctcgccaggatgtgccgcgccggcgagccgctgtgggtgcggcagcgtggcgcggaggtgatggccgtggaggagcacgcgcggatgttcagctggccggtggacggcgcgaagcagggagacggcggcgcggtggcgagggcggaggggacgcgtgacaacgcggtggtcatcatgaacagcatcaacttggtggacgccttcctcgatgcgaacaaatggatggagctgttcccgtcgattgtttgcaaggcaagaacaatccagatcataaaccacggagctgcgtctggtcacctcggcagtggaactctcctcttgatgcaagcagaggtgcagttcttgtcgcctctggtggcggcgcgcgaggtggtgttcttccgttactgcgtgcacaacgccgacgaggggagctgggcgatcgtggatttcccggcggaagggtttgaggaggggctcctccaagcctcggtggtcaggtgccggcggcggccgtccggctgcatcatccaggacatgcccaatggatactccagggtggtgtgggtggagcacatggagatggtcggggaggagaagccgctgcagccggtgttcagggactacgtcgccagcggcgccgccttcggggccacgcgctggctctccatcctccagcgccagtgcgagcgcctcgccagtgagctcgcccgtaacatcgccgacctcggagtgatccgcacccctgaggcaagaacaaatatgatgaagctgtcgcagcggatgatcaccactttctgtgctaacatcagtgcttctggaacccaatcttggacggccctctcggattcaacccaggacactatcagggttacaactcggaagaacactgagcccggacagcccagcggtgtcatcctcaccgctgtctccacaagctggcttccttttacccatcagcaggtgtttgagcttcttgcagatgaacaacagcgctgccagcttgagattttgtcaaacggcggctcccttcatgaggtggcacatattgcaaatggatcacatccaaggaattgcatctctcttcttcgcattaacgctgcaagcaactcgtcacagaatgtggagctcctgctgcaggagagcagcacccaccctgatggtgggagcctggtggtgttcgcgacggtggacgtggacgcaattcaggtgacgatgagcggcgaggatccttcctacatccctctcctccccctgggcttcgccatcttccctgccaccagcccatcacctgctgctgcacccaccatcagctcaagcaccaccaccaccactggcaatggcaatggcgaaaccagtagcactcctccaagaaacagcagcagcaacaacaacaatgcagatgagctgctgcctcccaatggctgcctcctcaccgtcggcatgcaggtgctggccagcgccgtaccttctgccaagctcaacctctcgagtgtcactgcgatcaacagccatgtctgcaacgccattcaccagatcacagctgcactcaaaagttcagcaggtggtgctgggggtgagccggcgtccgatcagtagcaaaggagacctggaggagaggggatcggagcaacatgggatcagacaccaaaatgcctcccaatttatttcgctaacatcgcagtttgtttttctgttagctctcggtctggctggttcatcaggtgcaagggagggtttgacaagaagccaacactaacagctactcaaatctctcctctcttcccgccatatttctgcctctcaaaatgacgaaaatacccccaaccagccaacaagcaaagccatggggggcattttgatcattttgggaagctacttctgctgagaaagaaagaaagaaagaaagggtcttgtcaagctctcacttgcaccaaccagctgattcatgaatttgctgacatcagctctgcaggcattttggtcgtgcatcggtttcttgctactccatccatccctctttaggttcttcctccctttcctcatcaaaagtgagaactgcatgtgaagaaggttagctccttgttttgaatttttgtaataataagatggaagaagaagacttggtagcttgagtgtgtggtttgtgttaagatcgagctagactttgtgtaaggttgaagaagaagaagacattaagcagattgttattaggagatgagataagagaaaggaggagaggagaagtcaagagcgaaccagttgtgacccttcttcacactagaagggggtcttggttcgggaattgacttgttacctctctgcactctttgtctgtaacctttgccctatcttattattactactagtattgttcatttttta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]