GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-16 13:56:18, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_015794996            1107 bp    mRNA    linear   PLN 10-JUL-2024
DEFINITION  PREDICTED: Oryza sativa Japonica Group calcium-binding protein
            CBP-like (LOC4346304), mRNA.
ACCESSION   XM_015794996
VERSION     XM_015794996.2
DBLINK      BioProject: PRJNA1123306
KEYWORDS    RefSeq.
SOURCE      Oryza sativa Japonica Group (Japanese rice)
  ORGANISM  Oryza sativa Japonica Group
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP
            clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_089042) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jul 10, 2024 this sequence version replaced XM_015794996.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_034140825.1-RS_2024_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/21/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1107
                     /organism="Oryza sativa Japonica Group"
                     /mol_type="mRNA"
                     /db_xref="taxon:39947"
                     /chromosome="8"
     gene            1..1107
                     /gene="LOC4346304"
                     /note="calcium-binding protein CBP-like; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 3 mRNAs, 30 ESTs, 417 long SRA reads, 8 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 133 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:4346304"
     misc_feature    1
                     /gene="LOC4346304"
                     /experiment="COORDINATES: cap analysis [ECO:0007248]"
                     /note="transcription start site"
     CDS             55..816
                     /gene="LOC4346304"
                     /codon_start=1
                     /product="calcium-binding protein CBP-like"
                     /protein_id="XP_015650482.1"
                     /db_xref="GeneID:4346304"
                     /translation="
MADYNRYGYGGYGSTPSAPPASSYGYTTTPSAPPASSSSSYGYGHGGGGYPSSTYPPPPPSSSQAYPMGMGGFLVFPPGTHPDVERAFRAVDRDGSGSIDERELQDALSSAYHRFSIRTVRLLLFLFNKPASHSPSRMGPAEFVSLWNCLGQWRGIFDRYDRDGSGKIEKDELREALRSLGYAVPPSVLELLIANYNNGVSSRGALDFDNFVECGMIVKGLTEKFKEKDTRYSGSATLSYDGFLSMVIPFIVP"
     misc_feature    301..804
                     /gene="LOC4346304"
                     /note="Penta-EF hand, calcium binding motifs, found in
                     Group I PEF proteins; Region: EFh_PEF_Group_I; cd16180"
                     /db_xref="CDD:320055"
     misc_feature    301..390
                     /gene="LOC4346304"
                     /note="EF-hand motif [structural motif]; Region: EF-hand
                     motif"
                     /db_xref="CDD:320055"
     misc_feature    order(328..330,334..336,340..342,361..363,535..537,
                     541..543,547..549,568..570,739..741,745..747,751..753)
                     /gene="LOC4346304"
                     /note="Ca binding site [ion binding]; other site"
                     /db_xref="CDD:320055"
     misc_feature    409..507
                     /gene="LOC4346304"
                     /note="EF-hand motif [structural motif]; Region: EF-hand
                     motif"
                     /db_xref="CDD:320055"
     misc_feature    508..597
                     /gene="LOC4346304"
                     /note="EF-hand motif [structural motif]; Region: EF-hand
                     motif"
                     /db_xref="CDD:320055"
     misc_feature    order(616..618,625..630,637..639,706..708,715..720,
                     724..729,754..777,781..786,793..798)
                     /gene="LOC4346304"
                     /note="homodimer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:320055"
     misc_feature    616..711
                     /gene="LOC4346304"
                     /note="EF-hand motif [structural motif]; Region: EF-hand
                     motif"
                     /db_xref="CDD:320055"
     misc_feature    712..804
                     /gene="LOC4346304"
                     /note="EF-hand motif [structural motif]; Region: EF-hand
                     motif"
                     /db_xref="CDD:320055"
     polyA_site      1107
                     /gene="LOC4346304"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
agttatctcttcgtttcttcttcttcctccttcgacgagagcaagcaagaagccatggcggactacaaccgctacggctacggcggctacggctccaccccgtcagcgccacccgcctcctcctacggctacaccaccacgccctccgccccaccggcctcctcctcctcgtcctacggctacggacatggcggcggcggttacccgtcctccacctacccaccgccgccgccgtcgtcgtcgcaggcgtatcccatggggatggggggcttcctggtgttcccgccggggacgcacccggacgtggagcgcgccttcagggccgtggaccgcgacggcagcggctccatcgacgagcgggagctgcaggacgcgctctcctccgcctaccaccgcttcagcatccgcaccgtccgcctcctcctcttcctcttcaacaaacctgcctcccattccccctctcgcatgggtccagcagagttcgtgtcactgtggaattgccttgggcaatggcggggcattttcgacagatacgatagggacgggagtggaaaaattgagaaagatgagttgagagaagctctacgcagtcttggatatgcggttccaccttctgtccttgagcttcttatcgcgaactacaacaatggagtctccagccgtggcgcgttggactttgacaactttgtggagtgtggaatgattgttaagggtttaactgaaaaattcaaagagaaggatacacgctacagcggctcggcaactctttcatatgacgggttcttgtcaatggtcattcccttcattgtcccttgacttcttcgggtgtctcaagacccaaagagctttgaatttgtacagcttttcagctatgtttctgcttcctagttggatttgtttgtgcaaataggccttggtgattttattgactctgtgccgtactgtgtacttagtaccattttgttttccctatagcctatatcgactgttacctgtgattgcgtctcggttctgacatgctttgatcttagttatcctcaaatgtaattgccttttgatgctaacagataatatgggagagtaaactcagcatctatgttcagtcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]