2025-03-02 05:22:45, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_015794996 1107 bp mRNA linear PLN 10-JUL-2024 DEFINITION PREDICTED: Oryza sativa Japonica Group calcium-binding protein CBP-like (LOC4346304), mRNA. ACCESSION XM_015794996 VERSION XM_015794996.2 DBLINK BioProject: PRJNA1123306 KEYWORDS RefSeq. SOURCE Oryza sativa Japonica Group (Japanese rice) ORGANISM Oryza sativa Japonica Group Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_089042) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Jul 10, 2024 this sequence version replaced XM_015794996.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_034140825.1-RS_2024_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/21/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1107 /organism="Oryza sativa Japonica Group" /mol_type="mRNA" /db_xref="taxon:39947" /chromosome="8" gene 1..1107 /gene="LOC4346304" /note="calcium-binding protein CBP-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 mRNAs, 30 ESTs, 417 long SRA reads, 8 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 133 samples with support for all annotated introns" /db_xref="GeneID:4346304" misc_feature 1 /gene="LOC4346304" /experiment="COORDINATES: cap analysis [ECO:0007248]" /note="transcription start site" CDS 55..816 /gene="LOC4346304" /codon_start=1 /product="calcium-binding protein CBP-like" /protein_id="XP_015650482.1" /db_xref="GeneID:4346304" /translation="
MADYNRYGYGGYGSTPSAPPASSYGYTTTPSAPPASSSSSYGYGHGGGGYPSSTYPPPPPSSSQAYPMGMGGFLVFPPGTHPDVERAFRAVDRDGSGSIDERELQDALSSAYHRFSIRTVRLLLFLFNKPASHSPSRMGPAEFVSLWNCLGQWRGIFDRYDRDGSGKIEKDELREALRSLGYAVPPSVLELLIANYNNGVSSRGALDFDNFVECGMIVKGLTEKFKEKDTRYSGSATLSYDGFLSMVIPFIVP"
misc_feature 301..804 /gene="LOC4346304" /note="Penta-EF hand, calcium binding motifs, found in Group I PEF proteins; Region: EFh_PEF_Group_I; cd16180" /db_xref="CDD:320055" misc_feature 301..390 /gene="LOC4346304" /note="EF-hand motif [structural motif]; Region: EF-hand motif" /db_xref="CDD:320055" misc_feature order(328..330,334..336,340..342,361..363,535..537, 541..543,547..549,568..570,739..741,745..747,751..753) /gene="LOC4346304" /note="Ca binding site [ion binding]; other site" /db_xref="CDD:320055" misc_feature 409..507 /gene="LOC4346304" /note="EF-hand motif [structural motif]; Region: EF-hand motif" /db_xref="CDD:320055" misc_feature 508..597 /gene="LOC4346304" /note="EF-hand motif [structural motif]; Region: EF-hand motif" /db_xref="CDD:320055" misc_feature order(616..618,625..630,637..639,706..708,715..720, 724..729,754..777,781..786,793..798) /gene="LOC4346304" /note="homodimer interface [polypeptide binding]; other site" /db_xref="CDD:320055" misc_feature 616..711 /gene="LOC4346304" /note="EF-hand motif [structural motif]; Region: EF-hand motif" /db_xref="CDD:320055" misc_feature 712..804 /gene="LOC4346304" /note="EF-hand motif [structural motif]; Region: EF-hand motif" /db_xref="CDD:320055" polyA_site 1107 /gene="LOC4346304" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
agttatctcttcgtttcttcttcttcctccttcgacgagagcaagcaagaagccatggcggactacaaccgctacggctacggcggctacggctccaccccgtcagcgccacccgcctcctcctacggctacaccaccacgccctccgccccaccggcctcctcctcctcgtcctacggctacggacatggcggcggcggttacccgtcctccacctacccaccgccgccgccgtcgtcgtcgcaggcgtatcccatggggatggggggcttcctggtgttcccgccggggacgcacccggacgtggagcgcgccttcagggccgtggaccgcgacggcagcggctccatcgacgagcgggagctgcaggacgcgctctcctccgcctaccaccgcttcagcatccgcaccgtccgcctcctcctcttcctcttcaacaaacctgcctcccattccccctctcgcatgggtccagcagagttcgtgtcactgtggaattgccttgggcaatggcggggcattttcgacagatacgatagggacgggagtggaaaaattgagaaagatgagttgagagaagctctacgcagtcttggatatgcggttccaccttctgtccttgagcttcttatcgcgaactacaacaatggagtctccagccgtggcgcgttggactttgacaactttgtggagtgtggaatgattgttaagggtttaactgaaaaattcaaagagaaggatacacgctacagcggctcggcaactctttcatatgacgggttcttgtcaatggtcattcccttcattgtcccttgacttcttcgggtgtctcaagacccaaagagctttgaatttgtacagcttttcagctatgtttctgcttcctagttggatttgtttgtgcaaataggccttggtgattttattgactctgtgccgtactgtgtacttagtaccattttgttttccctatagcctatatcgactgttacctgtgattgcgtctcggttctgacatgctttgatcttagttatcctcaaatgtaattgccttttgatgctaacagataatatgggagagtaaactcagcatctatgttcagtcaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]