GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-03-13 12:58:04, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_036152416            1336 bp    mRNA    linear   ROD 07-FEB-2024
DEFINITION  PREDICTED: Mus musculus transmembrane protein 40 (Tmem40),
            transcript variant X7, mRNA.
ACCESSION   XM_036152416
VERSION     XM_036152416.1
DBLINK      BioProject: PRJNA169
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000072.7) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_000001635.27-RS_2024_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/01/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1336
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6J"
                     /db_xref="taxon:10090"
                     /chromosome="6"
     gene            1..1336
                     /gene="Tmem40"
                     /gene_synonym="9030407H20Rik"
                     /note="transmembrane protein 40; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 8
                     ESTs, 24 long SRA reads, 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 4 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:94346"
                     /db_xref="MGI:MGI:2137870"
     CDS             332..802
                     /gene="Tmem40"
                     /gene_synonym="9030407H20Rik"
                     /codon_start=1
                     /product="transmembrane protein 40 isoform X5"
                     /protein_id="XP_036008309.1"
                     /db_xref="GeneID:94346"
                     /db_xref="MGI:MGI:2137870"
                     /translation="
MEASGSSSQSQDSGGVHRETEDHCADHGELEVLKDELQLCGGAAGEMVPTGESGLRRRGSGSAEGEVEASQLRRLNIKKDDEFFHFVLLCFAIGALLVCYHYYADWFMSLGVGLLTFASLETIGIYFGLVYRIHSVLQGFIPLLQKFRLPGFRRTN"
     misc_feature    437..796
                     /gene="Tmem40"
                     /gene_synonym="9030407H20Rik"
                     /note="Transmembrane protein 40 family; Region: TMEM40;
                     pfam15817"
                     /db_xref="CDD:464892"
ORIGIN      
ttcgctgctgtgaatagacaagggaatggctattcagcactttcagagagtggccggtggacacagaaactatctgcccaccacgagctgacagaggatctgactcctcctatcaactctgcagcgagggcaagagcaagcagaaagcaggccagaggcatggactgacatctcaccaagagaaaggaaaggaggaagctcatggccctgccttttatccctgctggtcggtactcccctggacagtggcagcaaacatttcctgtcctgttgctcagggtgactgatgagtgagcacaacgcagaggtggcagctgggtgagggaaagtcatggaggcttcaggatcttcttcccagtctcaagacagtggtggagtccacagggaaacggaagatcactgtgccgaccatggggaactggaagtgctaaaggacgagcttcagctctgcggaggtgctgctggggaaatggtgcctactggggagtcaggactccgaaggagaggttccggctcagcggagggagaagtggaggcctctcagttaagaagactgaacataaagaaggatgatgagtttttccattttgtccttctctgctttgccatcggagccttgctggtgtgttaccactactatgcagactggttcatgtccctcggggtcggcctgctcacctttgcttctctcgagaccattggcatctatttcgggctcgtgtaccggatccacagcgtgcttcagggcttcatccccctccttcagaagttccggctgccagggttcaggagaactaactgagatcactgcctgacagcagctgagccagtccccaatgtgaccactgtaaccactgccatgcctgagcccagaagacagaacgacgcgctggaagacaccagaaggccacacaataaagagctctttccttccacgtgatctgagtgtcggcaccagtgggcaggctcttgctctgcagattaacacgcagtctccgtggggaagagaagaggggatagcgtcgggtcagcacggaggagctgggatgccattgctcataggtcaacatgaatcctgggttctgcaggctggcatctgcgggcctgggtctctctggtgtcctcaggccatgcccaggagctcacagttcctgcagagccttcttgggacagccattctgaggcagggagctaccaggctgggttcccaggggaacttgttgcaggtaagacgctggggaccaaagctgcggacccatcatagctgaccaaccctgttgcccttggactcctaaaatccaaataaattttctgttccttgtgcttaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]