LOCUS       NR_166585                626 bp    RNA     linear   ROD 23-APR-2024
DEFINITION  Mus musculus LIM homeobox 5, antisense 1 (Lhx5as1), long non-coding
            RNA.
ACCESSION   NR_166585 XR_878744
VERSION     NR_166585.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 626)
  AUTHORS   Moreau,M.X., Saillour,Y., Elorriaga,V., Bouloudi,B., Delberghe,E.,
            Deutsch Guerrero,T., Ochandorena-Saa,A., Maeso-Alonso,L.,
            Marques,M.M., Marin,M.C., Spassky,N., Pierani,A. and Causeret,F.
  TITLE     Repurposing of the multiciliation gene regulatory network in fate
            specification of Cajal-Retzius neurons
  JOURNAL   Dev Cell 58 (15), 1365-1382 (2023)
   PUBMED   37321213
REFERENCE   2  (bases 1 to 626)
  AUTHORS   Cui,X., Zhang,R., Yang,Y., Wu,E., Tang,Y., Zhao,Z., Li,C., Yang,L.,
            Teng,X., Ye,Y., Cui,Y., Xu,F., Su,Z., Wang,D., Zhang,D., Yang,Y.,
            Sun,J., Luo,J., Zhang,S., Chen,R. and Xi,J.J.
  TITLE     Identification and characterization of long non-coding RNA Carip in
            modulating spatial learning and memory
  JOURNAL   Cell Rep 38 (8), 110398 (2022)
   PUBMED   35196493
REFERENCE   3  (bases 1 to 626)
  AUTHORS   Moreau,M.X., Saillour,Y., Cwetsch,A.W., Pierani,A. and Causeret,F.
  TITLE     Single-cell transcriptomics of the early developing mouse cerebral
            cortex disentangle the spatial and temporal components of neuronal
            fate acquisition
  JOURNAL   Development 148 (14) (2021)
   PUBMED   34170322
REFERENCE   4  (bases 1 to 626)
  AUTHORS   Li,J., Sun,L., Peng,X.L., Yu,X.M., Qi,S.J., Lu,Z.J., Han,J.J. and
            Shen,Q.
  TITLE     Integrative genomic analysis of early neurogenesis reveals a
            temporal genetic program for differentiation and specification of
            preplate and Cajal-Retzius neurons
  JOURNAL   PLoS Genet 17 (3), e1009355 (2021)
   PUBMED   33760820
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 626)
  AUTHORS   Harrow,J.L., Steward,C.A., Frankish,A., Gilbert,J.G.,
            Gonzalez,J.M., Loveland,J.E., Mudge,J., Sheppard,D., Thomas,M.,
            Trevanion,S. and Wilming,L.G.
  TITLE     The Vertebrate Genome Annotation browser 10 years on
  JOURNAL   Nucleic Acids Res 42 (Database issue), D771-D779 (2014)
   PUBMED   24316575
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC129553.10.
            
            On Mar 28, 2020 this sequence version replaced XR_878744.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AI430373.1, W89644.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01164131, SAMN01164136
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-81                AC129553.10        63311-63391
            82-626              AC129553.10        74878-75422
FEATURES             Location/Qualifiers
     source          1..626
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="5"
                     /map="5"
     gene            1..626
                     /gene="Lhx5as1"
                     /gene_synonym="Gm27199; Gm31976"
                     /note="LIM homeobox 5, antisense 1"
                     /db_xref="GeneID:102634302"
                     /db_xref="MGI:MGI:5521042"
     ncRNA           1..626
                     /ncRNA_class="lncRNA"
                     /gene="Lhx5as1"
                     /gene_synonym="Gm27199; Gm31976"
                     /product="LIM homeobox 5, antisense 1"
                     /db_xref="GeneID:102634302"
                     /db_xref="MGI:MGI:5521042"
     exon            1..81
                     /gene="Lhx5as1"
                     /gene_synonym="Gm27199; Gm31976"
                     /inference="alignment:Splign:2.1.0"
     exon            82..626
                     /gene="Lhx5as1"
                     /gene_synonym="Gm27199; Gm31976"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

acagcgttgcggtcagggcagagcaaaaaaaacaagacatcagtattgccgagtatttgctagtacctgttcccaagctaagatctctcattgaagttggagctcactgattccactagactgtctggtcagcaagcaatcaccaggaatcacctgtaaccgtatctgcctgccgtgacactcactgccgccttgaattatctatctatctatctatctatctatctatctatctatctatctatttatctttttattttcacacaagcagttgggaatataactcatatcctcatgcccacgcatcaagcatgttcctaactgagccatctccccagctcttggagtttctgggtttgttcggaagccttctccctcctccagaaagaggagtggaacaggcacatgtgaattcactctgttgagcctagaagaggtgaaagagaaaggctgcccattttctagatgttcctcatgagctatatgcgtgtaccacgaaggcttgcttggacccagagctagggctgacctaactgagatgctacccaggggtttctggctcactgtggccaccatggctccacaaaccacctacttataacaaaataaaaaattttctacaagga

//