LOCUS       NR_130333                 84 bp    RNA     linear   ROD 23-FEB-2021
DEFINITION  Mus musculus microRNA 466m (Mir466m), microRNA.
ACCESSION   NR_130333
VERSION     NR_130333.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 84)
  AUTHORS   Ji Q, Pan C, Wang J, Yang Z, Li C, Yang C, Zhang W, Wang M, Dong M,
            Sun Z and Nie S.
  TITLE     Long non-coding RNA Hsp4 alleviates lipopolysaccharide-induced
            apoptosis of lung epithelial cells via miRNA-466m-3p/DNAjb6 axis
  JOURNAL   Exp Mol Pathol 117, 104547 (2020)
   PUBMED   32976821
  REMARK    GeneRIF: Long non-coding RNA Hsp4 alleviates
            lipopolysaccharide-induced apoptosis of lung epithelial cells via
            miRNA-466m-3p/DNAjb6 axis.
REFERENCE   2  (bases 1 to 84)
  AUTHORS   Polikepahad S and Corry DB.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   3  (bases 1 to 84)
  AUTHORS   Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D,
            Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP,
            Nusbaum C and Bartel DP.
  TITLE     Mammalian microRNAs: experimental evaluation of novel and
            previously annotated genes
  JOURNAL   Genes Dev 24 (10), 992-1009 (2010)
   PUBMED   20413612
REFERENCE   4  (bases 1 to 84)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL772216.15.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: SRR7345562.2290708.1,
                                        SRR7652917.383295.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-84                AL772216.15        42697-42780
FEATURES             Location/Qualifiers
     source          1..84
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="2"
                     /map="2 8.22 cM"
     gene            1..84
                     /gene="Mir466m"
                     /gene_synonym="mmu-mir-466m"
                     /note="microRNA 466m"
                     /db_xref="GeneID:100526481"
                     /db_xref="MGI:MGI:4834277"
                     /db_xref="miRBase:MI0014050"
     precursor_RNA   1..84
                     /gene="Mir466m"
                     /gene_synonym="mmu-mir-466m"
                     /product="microRNA 466m"
                     /db_xref="GeneID:100526481"
                     /db_xref="MGI:MGI:4834277"
                     /db_xref="miRBase:MI0014050"
     exon            1..84
                     /gene="Mir466m"
                     /gene_synonym="mmu-mir-466m"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           15..37
                     /ncRNA_class="miRNA"
                     /gene="Mir466m"
                     /gene_synonym="mmu-mir-466m"
                     /product="mmu-miR-466m-5p"
                     /db_xref="miRBase:MIMAT0014882"
                     /db_xref="GeneID:100526481"
                     /db_xref="MGI:MGI:4834277"
                     /db_xref="miRBase:MI0014050"
     ncRNA           51..72
                     /ncRNA_class="miRNA"
                     /gene="Mir466m"
                     /gene_synonym="mmu-mir-466m"
                     /product="mmu-miR-466m-3p"
                     /db_xref="miRBase:MIMAT0014883"
                     /db_xref="GeneID:100526481"
                     /db_xref="MGI:MGI:4834277"
                     /db_xref="miRBase:MI0014050"
ORIGIN      

tgtgtgtgttcttgtgtgtgcatgtgcatgtgtgtatatgaatatacatatacatacacacatacacacgcacgtacacacaca

//