2025-08-21 17:06:57, GGRNA.v2 : RefSeq release 230 (May, 2025)
LOCUS NR_038086 1117 bp RNA linear ROD 17-SEP-2024 DEFINITION Mus musculus SIX homeobox 3, opposite strand 1 (Six3os1), transcript variant 8, long non-coding RNA. ACCESSION NR_038086 VERSION NR_038086.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1117) AUTHORS Song,X., Chen,H., Shang,Z., Du,H., Li,Z., Wen,Y., Liu,G., Qi,D., You,Y., Yang,Z., Zhang,Z. and Xu,Z. TITLE Homeobox Gene Six3 is Required for the Differentiation of D2-Type Medium Spiny Neurons JOURNAL Neurosci Bull 37 (7), 985-998 (2021) PUBMED 34014554 REFERENCE 2 (bases 1 to 1117) AUTHORS Quintana-Urzainqui,I., Kozic,Z., Mitra,S., Tian,T., Manuel,M., Mason,J.O. and Price,D.J. TITLE Tissue-Specific Actions of Pax6 on Proliferation and Differentiation Balance in Developing Forebrain Are Foxg1 Dependent JOURNAL iScience 10, 171-191 (2018) PUBMED 30529950 REFERENCE 3 (bases 1 to 1117) AUTHORS Percival,C.J., Green,R., Roseman,C.C., Gatti,D.M., Morgan,J.L., Murray,S.A., Donahue,L.R., Mayeux,J.M., Pollard,K.M., Hua,K., Pomp,D., Marcucio,R. and Hallgrimsson,B. TITLE Developmental constraint through negative pleiotropy in the zygomatic arch JOURNAL Evodevo 9, 3 (2018) PUBMED 29423138 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 1117) AUTHORS Rapicavoli,N.A., Poth,E.M., Zhu,H. and Blackshaw,S. TITLE The long noncoding RNA Six3OS acts in trans to regulate retinal development by modulating Six3 activity JOURNAL Neural Dev 6, 32 (2011) PUBMED 21936910 REMARK GeneRIF: Six3OS regulates Six3 activity in developing retina by a mechanism via which promoter-associated long non-coding RNAs can modulate the activity of their associated protein coding genes during development. Publication Status: Online-Only REFERENCE 5 (bases 1 to 1117) AUTHORS Geng,X., Lavado,A., Lagutin,O.V., Liu,W. and Oliver,G. TITLE Expression of Six3 Opposite Strand (Six3OS) during mouse embryonic development JOURNAL Gene Expr Patterns 7 (3), 252-257 (2007) PUBMED 17084678 REFERENCE 6 (bases 1 to 1117) AUTHORS Alfano,G., Vitiello,C., Caccioppoli,C., Caramico,T., Carola,A., Szego,M.J., McInnes,R.R., Auricchio,A. and Banfi,S. TITLE Natural antisense transcripts associated with genes involved in eye development JOURNAL Hum Mol Genet 14 (7), 913-923 (2005) PUBMED 15703187 REFERENCE 7 (bases 1 to 1117) AUTHORS Blackshaw,S., Harpavat,S., Trimarchi,J., Cai,L., Huang,H., Kuo,W.P., Weber,G., Lee,K., Fraioli,R.E., Cho,S.H., Yung,R., Asch,E., Ohno-Machado,L., Wong,W.H. and Cepko,C.L. TITLE Genomic analysis of mouse retinal development JOURNAL PLoS Biol 2 (9), E247 (2004) PUBMED 15226823 REFERENCE 8 (bases 1 to 1117) AUTHORS Mu,X., Zhao,S., Pershad,R., Hsieh,T.F., Scarpa,A., Wang,S.W., White,R.A., Beremand,P.D., Thomas,T.L., Gan,L. and Klein,W.H. TITLE Gene expression in the developing mouse retina by EST sequencing and microarray analysis JOURNAL Nucleic Acids Res 29 (24), 4983-4993 (2001) PUBMED 11812828 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AK053722.1, CA527570.1 and AC166821.2. Transcript Variant: This variant (8) lacks an internal segment, compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: CA527570.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN01164138, SAMN01164139 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-56 AK053722.1 3-58 57-656 CA527570.1 1-600 657-1117 AC166821.2 67003-67463 c FEATURES Location/Qualifiers source 1..1117 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="17" /map="17 55.42 cM" gene 1..1117 /gene="Six3os1" /gene_synonym="D17Mgi26; E130112H22Rik; Rncr1; Six3os" /note="SIX homeobox 3, opposite strand 1" /db_xref="GeneID:100043902" /db_xref="MGI:MGI:1925118" ncRNA 1..1117 /ncRNA_class="lncRNA" /gene="Six3os1" /gene_synonym="D17Mgi26; E130112H22Rik; Rncr1; Six3os" /product="SIX homeobox 3, opposite strand 1, transcript variant 8" /db_xref="GeneID:100043902" /db_xref="MGI:MGI:1925118" exon 1..340 /gene="Six3os1" /gene_synonym="D17Mgi26; E130112H22Rik; Rncr1; Six3os" /inference="alignment:Splign:2.1.0" exon 341..490 /gene="Six3os1" /gene_synonym="D17Mgi26; E130112H22Rik; Rncr1; Six3os" /inference="alignment:Splign:2.1.0" exon 491..535 /gene="Six3os1" /gene_synonym="D17Mgi26; E130112H22Rik; Rncr1; Six3os" /inference="alignment:Splign:2.1.0" exon 536..1117 /gene="Six3os1" /gene_synonym="D17Mgi26; E130112H22Rik; Rncr1; Six3os" /inference="alignment:Splign:2.1.0" ORIGIN
aaaaccctcgccactcatgaagaactgaggcaaaaggatcacagatgctgctcggggccagccctatactccctccagtgcctggtctccggtggacccgcggggctctgcagttctctggcggccgcgccttgtaagcgctaagccgggaggagggcgcaggcagggcgcacagctctgagcgcgaccctacccggctcgggcccgcagcaaccccgactgtccgagagcctctccccaagcaaggctctgcgccgccctctgagcccacctcctggccacaacgctgcctgcgcttctccagcccaggccggaagccctatgctgcctcccgaagccggactttctggaagcccatcttcgtatgctcaccagcccaccctcctacgctggtcagagtgagattgctaacctcaagaccccattcaatgccagctttcaactactgctgaagaccaatgtaggtcctggaatagaagaactgcagagtatccggagctggccgaccccagactgattctcaacaggtggctggcgtcaatgctctagagatgggacctcgccttccaaggtgtcttcactatcacagggcccgggctctctgcctcagcccaaccctgggcttgcgctcagagaggaggtattccgacggaaaaaaatcccatacatttttaactacagtgattactaaattaatagcaggcaccaagacagatgtcaaaacgtcttgaaaatgtttatctgtgaataattgagaaggtagtgggacgcattatctgattgtgtaatgaaatatgtatgaggaacagctgtttgcagcagccccttccccttgccgccttagccagggcccttctctcgcaagctttcttctactttcttccacctttttcttccttctactttctagttcgctctcttcttccttaactgctcgcacggctttggctgcagtgaacccagagtcgcctggttctctgatgaaggttagccacaaggtttcctctaagccttgctggattggcgttccgtagtgggatgaggcttcgttgtctgctgttctggccatcgcgccttccggccaggctgcccgctgggtctccatggagtctgcggg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]