2024-05-17 15:34:36, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_029624 1861 bp mRNA linear ROD 18-DEC-2022 DEFINITION Mus musculus lipase maturation factor 1 (Lmf1), transcript variant 1, mRNA. ACCESSION NM_029624 VERSION NM_029624.4 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1861) AUTHORS Sha H, Sun S, Francisco AB, Ehrhardt N, Xue Z, Liu L, Lawrence P, Mattijssen F, Guber RD, Panhwar MS, Brenna JT, Shi H, Xue B, Kersten S, Bensadoun A, Peterfy M, Long Q and Qi L. TITLE The ER-associated degradation adaptor protein Sel1L regulates LPL secretion and lipid metabolism JOURNAL Cell Metab 20 (3), 458-470 (2014) PUBMED 25066055 REFERENCE 2 (bases 1 to 1861) AUTHORS Mao HZ, Ehrhardt N, Bedoya C, Gomez JA, DeZwaan-McCabe D, Mungrue IN, Kaufman RJ, Rutkowski DT and Peterfy M. TITLE Lipase maturation factor 1 (lmf1) is induced by endoplasmic reticulum stress through activating transcription factor 6alpha (Atf6alpha) signaling JOURNAL J Biol Chem 289 (35), 24417-24427 (2014) PUBMED 25035425 REMARK GeneRIF: determined the alpha-synuclein-binding domain of beta-III tubulin and demonstrated that a short fragment containing this domain can suppress alpha-synuclein accumulation in the primary cultured cells REFERENCE 3 (bases 1 to 1861) AUTHORS Ehrhardt N, Bedoya C and Peterfy M. TITLE Embryonic viability, lipase deficiency, hypertriglyceridemia and neonatal lethality in a novel LMF1-deficient mouse model JOURNAL Nutr Metab (Lond) 11, 37 (2014) PUBMED 25302068 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 1861) AUTHORS Hosseini M, Ehrhardt N, Weissglas-Volkov D, Lai CM, Mao HZ, Liao JL, Nikkola E, Bensadoun A, Taskinen MR, Doolittle MH, Pajukanta P and Peterfy M. TITLE Transgenic expression and genetic variation of Lmf1 affect LPL activity in mice and humans JOURNAL Arterioscler Thromb Vasc Biol 32 (5), 1204-1210 (2012) PUBMED 22345169 REMARK GeneRIF: variation in Lmf1 expression is a posttranslational determinant of LPL activity. REFERENCE 5 (bases 1 to 1861) AUTHORS Yin F, Doolittle MH and Peterfy M. TITLE A quantitative assay measuring the function of lipase maturation factor 1 JOURNAL J Lipid Res 50 (11), 2265-2269 (2009) PUBMED 19471043 REMARK GeneRIF: Results show that cotransfection of LPL with wild-type Lmf1 restores its ability to support normal lipase maturation. REFERENCE 6 (bases 1 to 1861) AUTHORS Ebersole T, Lai F and Artzt K. TITLE New molecular markers for the distal end of the t-complex and their relationships to mutations affecting mouse development JOURNAL Genetics 131 (1), 175-182 (1992) PUBMED 1350556 REFERENCE 7 (bases 1 to 1861) AUTHORS Lai F and Artzt K. TITLE Map positions of four dinucleotide repeats in the mouse t complex JOURNAL Mamm Genome 3 (8), 476-477 (1992) PUBMED 1643311 REFERENCE 8 (bases 1 to 1861) AUTHORS Oka K, Nakano T, Tkalcevic GT, Scow RO and Brown WV. TITLE Molecular cloning of mouse hepatic triacylglycerol lipase: gene expression in combined lipase-deficient (cld/cld) mice JOURNAL Biochim Biophys Acta 1089 (1), 13-20 (1991) PUBMED 2025643 REFERENCE 9 (bases 1 to 1861) AUTHORS Davis RC, Ben-Zeev O, Martin D and Doolittle MH. TITLE Combined lipase deficiency in the mouse. Evidence of impaired lipase processing and secretion JOURNAL J Biol Chem 265 (29), 17960-17966 (1990) PUBMED 2211673 REFERENCE 10 (bases 1 to 1861) AUTHORS Oka K, Yuan JG, Senda M, Masibay AS, Qasba PK, Masuno H, Scow RO, Paterniti JR Jr and Brown WV. TITLE Expression of lipoprotein lipase gene in combined lipase deficiency JOURNAL Biochim Biophys Acta 1008 (3), 351-354 (1989) PUBMED 2474325 REMARK Erratum:[Biochim Biophys Acta 1989 Nov 2;1009(2):199. Oasba PK [corrected to Qasba PK]] COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from BY229784.1, AK010312.1 and BQ031829.1. On Nov 16, 2011 this sequence version replaced NM_029624.3. Transcript Variant: This variant (1) represents the longer transcript and is protein coding. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK154622.1, BC020104.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849374, SAMN00849375 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression, longest protein ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-25 BY229784.1 2-26 26-30 BY229784.1 28-32 31-1758 AK010312.1 2-1729 1759-1861 BQ031829.1 17-119 c FEATURES Location/Qualifiers source 1..1861 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="17" /map="17 12.7 cM" gene 1..1861 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /note="lipase maturation factor 1" /db_xref="GeneID:76483" /db_xref="MGI:MGI:1923733" exon 1..206 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /inference="alignment:Splign:2.1.0" CDS 14..1738 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /note="transmembrane protein 112" /codon_start=1 /product="lipase maturation factor 1" /protein_id="NP_083900.3" /db_xref="CCDS:CCDS37502.2" /db_xref="GeneID:76483" /db_xref="MGI:MGI:1923733" /translation="
MRPDSLVMAAPEGSLRKRKVGGAEHSPASQPSLARDPADSPARLHTGTFWLTRIVLLRALAFIYFVAFLVAFNQNKALIGDRGLLPCKLYLKNVQEYFQGSTGWAAWTYAPTIMWLLDWSDMNFNLDLIALLGLGISSFVLVTGCANMILMTALWALYMSLVNVGQIWYSFGWESQLLETGFLGIFLSPLWTLSRLPKNTPTSQIVLWGFRWLIFRIMLGAGLIKVRGDKCWLDLTCMDFHYETQPVPNPIAYYLHRSPWWFHRFETLSNHFVELLVPFFLFLGRRMRILHGVLQILFQVILIISGNLSFLNWLTIVPSLACFDDAALGFLFPSGPQGLKKQVLEIQREDTQRVQPKPRDRGCLVRQVVNISLGILVAWLSVPVVINLLSSRQIMNTSFNPLRIVNTYGAFGSVTKERTEVILQGTVSPNASAPDAVWEDYEFKCKPGDPWRQPCLISPYHYRLDWLMWFAAFQTYEQNEWILHLAGKLLAGDSEALALLAVNPFEGRTPPRWIRGEHYRYKFSLPGGQHATQGKWWIRKRIGPYFPPLRLEDLKEYFKTREWPLPEPPSRHTR"
misc_feature 14..130 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /note="propagated from UniProtKB/Swiss-Prot (Q3U3R4.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 161..229 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /note="propagated from UniProtKB/Swiss-Prot (Q3U3R4.1); transmembrane region" misc_feature 395..466 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /note="propagated from UniProtKB/Swiss-Prot (Q3U3R4.1); transmembrane region" misc_feature 518..1654 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /note="Lipase maturation factor; Region: LMF1; pfam06762" /db_xref="CDD:429107" misc_feature 635..676 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /note="propagated from UniProtKB/Swiss-Prot (Q3U3R4.1); transmembrane region" misc_feature 890..976 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /note="propagated from UniProtKB/Swiss-Prot (Q3U3R4.1); transmembrane region" misc_feature 1115..1177 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /note="propagated from UniProtKB/Swiss-Prot (Q3U3R4.1); transmembrane region" exon 207..516 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /inference="alignment:Splign:2.1.0" exon 517..527 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /inference="alignment:Splign:2.1.0" exon 528..676 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /inference="alignment:Splign:2.1.0" exon 677..742 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /inference="alignment:Splign:2.1.0" exon 743..910 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /inference="alignment:Splign:2.1.0" exon 911..1097 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /inference="alignment:Splign:2.1.0" exon 1098..1251 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /inference="alignment:Splign:2.1.0" exon 1252..1435 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /inference="alignment:Splign:2.1.0" exon 1436..1548 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /inference="alignment:Splign:2.1.0" exon 1549..1861 /gene="Lmf1" /gene_synonym="2400010G15Rik; cld; Tmem112" /inference="alignment:Splign:2.1.0" ORIGIN
gccctttgtgctcatgcgcccagacagcctagtaatggctgcgcccgaggggtcgctgagaaaacggaaggtcgggggtgcggagcacagtccagcgtcgcaaccttctctggctagagatcccgcagattctccagctcggctgcacacgggcaccttctggctgactagaatcgtgctcctgcgggccctcgctttcatttactttgtggcctttttggtggcattcaatcagaacaaggccctcatcggtgaccggggcctgctgccctgcaaactgtacctgaagaatgtccaggagtacttccagggcagcactggctgggctgcctggacctatgcaccaaccattatgtggttgttggactggtcagacatgaacttcaacctggacctcattgctcttcttgggctgggcatctcgtcctttgtcctggtgaccggctgtgccaacatgatactcatgactgccctctgggccctctacatgtccctggtcaacgtagggcagatctggtattcttttggatgggagtcacagctgctggaaacaggattcctggggatctttctgagccctctctggacactgtcccgcctgcccaagaacacccccacatcccagattgtcctgtggggcttccgctggctgatcttcagaatcatgcttggagcgggcctcatcaaggtccgcggggacaagtgctggctggatctgacctgcatggacttccactatgagactcagcccgtgcccaacccgatagcctactacctgcacaggtcaccatggtggttccaccgctttgagaccctcagcaaccacttcgtggagcttcttgtgcctttcttcctgttccttggacggcggatgcgcattcttcatggagtgctgcagatccttttccaggtgatcctcatcatcagtgggaacctgagcttcctgaactggctcaccatcgtgcccagccttgcctgcttcgacgatgcagctctgggattcctgtttccctcaggacctcaaggcctaaagaagcaagtcctggagattcagagggaagatacacaaagggtccagcccaagccaagagacagaggctgcttggtgcggcaagtggtcaacatctccctgggcatcctggtggcctggctcagcgtacccgtggttatcaatctgctaagctccaggcagatcatgaacacctccttcaacccgctcaggatcgtcaacacctatggggcctttggaagtgtcaccaaagagcggactgaggtgatcctgcagggcacagtgagccccaacgccagcgcacctgatgcagtgtgggaagactatgagttcaagtgcaaaccgggcgacccctggaggcagccatgcctcatctcgccataccactaccgcctggactggctgatgtggttcgcagctttccagacctatgagcagaacgagtggatccttcatctggcgggtaagctcctagctggtgactctgaagccctggccctacttgctgttaacccctttgagggcaggactccccccaggtggatccgaggagaacactaccggtacaagttcagcctccccgggggccagcacgccacccagggcaagtggtggatccgcaagcgaattggtccttacttccccccactccgccttgaggatctgaaggaatactttaagactcgggagtggccactaccagaacccccatctagacacacacgctgaaataaagaccagagaccaaccgcttctctacctatactgtgctgcggccacgggacccgcacagggacccggcagcccatggatcctgccaagaagagattggaaaaggatgtgcttcctagc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]