LOCUS       NM_023504               1065 bp    mRNA    linear   ROD 02-JUN-2024
DEFINITION  Mus musculus NK2 homeobox 4 (Nkx2-4), mRNA.
ACCESSION   NM_023504
VERSION     NM_023504.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1065)
  AUTHORS   Shen,T., Ji,F., Wang,Y., Lei,X., Zhang,D. and Jiao,J.
  TITLE     Brain-specific deletion of histone variant H2A.z results in
            cortical neurogenesis defects and neurodevelopmental disorder
  JOURNAL   Nucleic Acids Res 46 (5), 2290-2307 (2018)
   PUBMED   29294103
REFERENCE   2  (bases 1 to 1065)
  AUTHORS   Sokolowski,K., Esumi,S., Hirata,T., Kamal,Y., Tran,T., Lam,A.,
            Oboti,L., Brighthaupt,S.C., Zaghlula,M., Martinez,J.,
            Ghimbovschi,S., Knoblach,S., Pierani,A., Tamamaki,N., Shah,N.M.,
            Jones,K.S. and Corbin,J.G.
  TITLE     Specification of select hypothalamic circuits and innate behaviors
            by the embryonic patterning gene dbx1
  JOURNAL   Neuron 86 (2), 403-416 (2015)
   PUBMED   25864637
REFERENCE   3  (bases 1 to 1065)
  AUTHORS   Correa,S.M., Newstrom,D.W., Warne,J.P., Flandin,P., Cheung,C.C.,
            Lin-Moore,A.T., Pierce,A.A., Xu,A.W., Rubenstein,J.L. and
            Ingraham,H.A.
  TITLE     An estrogen-responsive module in the ventromedial hypothalamus
            selectively drives sex-specific activity in females
  JOURNAL   Cell Rep 10 (1), 62-74 (2015)
   PUBMED   25543145
REFERENCE   4  (bases 1 to 1065)
  AUTHORS   Thompson,C.L., Ng,L., Menon,V., Martinez,S., Lee,C.K.,
            Glattfelder,K., Sunkin,S.M., Henry,A., Lau,C., Dang,C.,
            Garcia-Lopez,R., Martinez-Ferre,A., Pombero,A., Rubenstein,J.L.R.,
            Wakeman,W.B., Hohmann,J., Dee,N., Sodt,A.J., Young,R., Smith,K.,
            Nguyen,T.N., Kidney,J., Kuan,L., Jeromin,A., Kaykas,A., Miller,J.,
            Page,D., Orta,G., Bernard,A., Riley,Z., Smith,S., Wohnoutka,P.,
            Hawrylycz,M.J., Puelles,L. and Jones,A.R.
  TITLE     A high-resolution spatiotemporal atlas of gene expression of the
            developing mouse brain
  JOURNAL   Neuron 83 (2), 309-323 (2014)
   PUBMED   24952961
REFERENCE   5  (bases 1 to 1065)
  AUTHORS   Pereira,J.D., Sansom,S.N., Smith,J., Dobenecker,M.W.,
            Tarakhovsky,A. and Livesey,F.J.
  TITLE     Ezh2, the histone methyltransferase of PRC2, regulates the balance
            between self-renewal and differentiation in the cerebral cortex
  JOURNAL   Proc Natl Acad Sci U S A 107 (36), 15957-15962 (2010)
   PUBMED   20798045
REFERENCE   6  (bases 1 to 1065)
  AUTHORS   Guo,G., Huss,M., Tong,G.Q., Wang,C., Li Sun,L., Clarke,N.D. and
            Robson,P.
  TITLE     Resolution of cell fate decisions revealed by single-cell gene
            expression analysis from zygote to blastocyst
  JOURNAL   Dev Cell 18 (4), 675-685 (2010)
   PUBMED   20412781
REFERENCE   7  (bases 1 to 1065)
  AUTHORS   Marin,O., Baker,J., Puelles,L. and Rubenstein,J.L.
  TITLE     Patterning of the basal telencephalon and hypothalamus is essential
            for guidance of cortical projections
  JOURNAL   Development 129 (3), 761-773 (2002)
   PUBMED   11830575
REFERENCE   8  (bases 1 to 1065)
  AUTHORS   Wang,C.C., Brodnicki,T., Copeland,N.G., Jenkins,N.A. and
            Harvey,R.P.
  TITLE     Conserved linkage of NK-2 homeobox gene pairs Nkx2-2/2-4 and
            Nkx2-1/2-9 in mammals
  JOURNAL   Mamm Genome 11 (6), 466-468 (2000)
   PUBMED   10818213
REFERENCE   9  (bases 1 to 1065)
  AUTHORS   Yoshiura,K.I. and Murray,J.C.
  TITLE     Sequence and chromosomal assignment of human BAPX1, a
            bagpipe-related gene, to 4p16.1: a candidate gene for skeletal
            dysplasia
  JOURNAL   Genomics 45 (2), 425-428 (1997)
   PUBMED   9344671
REFERENCE   10 (bases 1 to 1065)
  AUTHORS   Price,M., Lazzaro,D., Pohl,T., Mattei,M.G., Ruther,U., Olivo,J.C.,
            Duboule,D. and Di Lauro,R.
  TITLE     Regional expression of the homeobox gene Nkx-2.2 in the developing
            mammalian forebrain
  JOURNAL   Neuron 8 (2), 241-255 (1992)
   PUBMED   1346742
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF202038.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF202039.1, ERR3363657.62994.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849383, SAMN01164138
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1065
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="129/Sv"
                     /db_xref="taxon:10090"
                     /chromosome="2"
                     /map="2 72.63 cM"
     gene            1..1065
                     /gene="Nkx2-4"
                     /gene_synonym="1700001P03Rik; Nkx-2.4; tinman"
                     /note="NK2 homeobox 4"
                     /db_xref="GeneID:228731"
                     /db_xref="MGI:MGI:97349"
     CDS             1..1065
                     /gene="Nkx2-4"
                     /gene_synonym="1700001P03Rik; Nkx-2.4; tinman"
                     /note="homeobox protein NK-2 homolog D; NK2 transcription
                     factor related, locus 4"
                     /codon_start=1
                     /product="homeobox protein Nkx-2.4"
                     /protein_id="NP_075993.1"
                     /db_xref="CCDS:CCDS16833.1"
                     /db_xref="GeneID:228731"
                     /db_xref="MGI:MGI:97349"
                     /translation="

MSLSPKHTTPFSVSDILSPIEETYKKFGGVMDGAPPGLGAPLGAAAYRAPPSGPSSQAAAVAAGMQPPHAMAGHNAAAAAAAAAAAAAAAATYHMPPGVSQFPHSAMGSYCNGGLGNMGELPAYTDGMRGGAAAAATGWYGANTDPRYSSISRFMGPSAGVNVAGMGSLTGIADAAKSLAPLHAAAPRRKRRVLFSQAQVYELERRFKQQKYLSAPEREHLASMIHLTPTQVKIWFQNHRYKMKRQAKDKAAQQLQQEGGLGPPPPPPPPSPRRVAVPVLVKDGKPCQNGAGTPTPGQGGQQPQAPTPAPELEELSPSPPALHGPGGGLAALDAATGDYGGGVLGANLLYGRTW"

     misc_feature    565..735
                     /gene="Nkx2-4"
                     /gene_synonym="1700001P03Rik; Nkx-2.4; tinman"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    733..987
                     /gene="Nkx2-4"
                     /gene_synonym="1700001P03Rik; Nkx-2.4; tinman"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9EQM3.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            1..451
                     /gene="Nkx2-4"
                     /gene_synonym="1700001P03Rik; Nkx-2.4; tinman"
                     /inference="alignment:Splign:2.1.0"
     exon            452..1065
                     /gene="Nkx2-4"
                     /gene_synonym="1700001P03Rik; Nkx-2.4; tinman"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atgtcgttgagccccaagcacacgacgcccttctccgtttccgacatcctgagccccatcgaggagacctacaagaagttcggcggcgtcatggacggtgcgccgcccggcctgggggcgcccctgggggccgctgcctaccgcgcgccaccgagcggcccctcctcgcaggcggcggccgtggcggcgggcatgcagccgccccacgccatggccggacacaacgcggcggcggcagcagcggcggcagcggcggcggccgcggcggccgccacctaccacatgcctcccggcgtctcgcagttcccgcacagcgccatgggcagctactgcaacggcggcctgggcaacatgggtgagctgcccgcctacacggacggcatgcggggcggcgcggcggccgcggccaccggctggtacggcgccaacacggacccgcgctactcgtcaatctccaggttcatggggccgtcggcgggcgtgaacgtggccggcatgggttcgctgaccggcatcgcggacgccgccaagtcgctggcaccgctgcacgcggccgcgccgcgaaggaagcgccgagtgctcttctcgcaagcgcaggtctacgagctggagcggcgcttcaagcagcagaagtacctgtcggcgcccgagcgcgagcacctggccagcatgatccacctgacgcccacgcaggtcaagatctggttccagaaccatcgctacaagatgaagaggcaggccaaggacaaggcggcgcagcagctgcaacaggagggcggcctgggccccccgccgcctccgccgccgccgtcgccgcgccgcgtggcggtaccggtgctggtgaaggacggcaagccgtgccagaacggcgcgggcaccccgacgcctggccagggaggccagcagccgcaagccccgacgcccgcgccagagctcgaggagctgtcgcccagcccgcccgctctgcatggtcccgggggcggcttagcggccctggacgcggccaccggggactacggcggaggcgtgctcggcgccaacctgctctatggcagaacgtggtga

//