LOCUS       NM_021901               2030 bp    mRNA    linear   ROD 04-OCT-2024
DEFINITION  Mus musculus T cell leukemia, homeobox 1 (Tlx1), mRNA.
ACCESSION   NM_021901
VERSION     NM_021901.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 2030)
  AUTHORS   Hand,A.R., Abramson,C.X.G. and Dressler,K.A.
  TITLE     Tlx1 regulates acinar and duct development in mouse salivary glands
  JOURNAL   J Anat 244 (2), 343-357 (2024)
   PUBMED   37837237
  REMARK    GeneRIF: Tlx1 regulates acinar and duct development in mouse
            salivary glands.
REFERENCE   2  (bases 1 to 2030)
  AUTHORS   Ye,Q., Bhojwani,A. and Hu,J.K.
  TITLE     Understanding the development of oral epithelial organs through
            single cell transcriptomic analysis
  JOURNAL   Development 149 (16) (2022)
   PUBMED   35831953
REFERENCE   3  (bases 1 to 2030)
  AUTHORS   Rux,D., Helbig,K., Koyama,E. and Pacifici,M.
  TITLE     Hox11 expression characterizes developing zeugopod synovial joints
            and is coupled to postnatal articular cartilage morphogenesis into
            functional zones in mice
  JOURNAL   Dev Biol 477, 49-63 (2021)
   PUBMED   34010606
  REMARK    GeneRIF: Hox11 expression characterizes developing zeugopod
            synovial joints and is coupled to postnatal articular cartilage
            morphogenesis into functional zones in mice.
REFERENCE   4  (bases 1 to 2030)
  AUTHORS   Mona,B., Villarreal,J., Savage,T.K., Kollipara,R.K., Boisvert,B.E.
            and Johnson,J.E.
  TITLE     Positive autofeedback regulation of Ptf1a transcription generates
            the levels of PTF1A required to generate itch circuit neurons
  JOURNAL   Genes Dev 34 (9-10), 621-636 (2020)
   PUBMED   32241803
REFERENCE   5  (bases 1 to 2030)
  AUTHORS   Ueno,Y., Fujisaki,K., Hosoda,S., Amemiya,Y., Okazaki,S., Notsu,C.,
            Nishiyama,C., Mabuchi,Y., Matsuzaki,Y., Oda,A. and Goitsuka,R.
  TITLE     Transcription factor Tlx1 marks a subset of lymphoid tissue
            organizer-like mesenchymal progenitor cells in the neonatal spleen
  JOURNAL   Sci Rep 9 (1), 20408 (2019)
   PUBMED   31892733
  REMARK    GeneRIF: Transcription factor Tlx1 marks a subset of lymphoid
            tissue organizer-like mesenchymal progenitor cells in the neonatal
            spleen.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2030)
  AUTHORS   Dear,T.N., Colledge,W.H., Carlton,M.B., Lavenir,I., Larson,T.,
            Smith,A.J., Warren,A.J., Evans,M.J., Sofroniew,M.V. and
            Rabbitts,T.H.
  TITLE     The Hox11 gene is essential for cell survival during spleen
            development
  JOURNAL   Development 121 (9), 2909-2915 (1995)
   PUBMED   7555717
REFERENCE   7  (bases 1 to 2030)
  AUTHORS   Tang,S. and Breitman,M.L.
  TITLE     The optimal binding sequence of the Hox11 protein contains a
            predicted recognition core motif
  JOURNAL   Nucleic Acids Res 23 (11), 1928-1935 (1995)
   PUBMED   7596820
REFERENCE   8  (bases 1 to 2030)
  AUTHORS   Wen,X.Y., Tang,S. and Breitman,M.L.
  TITLE     Genetic mapping of two mouse homeobox genes Tlx-1 and Tlx-2 to
            murine chromosomes 19 and 6
  JOURNAL   Genomics 24 (2), 388-390 (1994)
   PUBMED   7698766
REFERENCE   9  (bases 1 to 2030)
  AUTHORS   Scott,M.P.
  TITLE     Vertebrate homeobox gene nomenclature
  JOURNAL   Cell 71 (4), 551-553 (1992)
   PUBMED   1358459
REFERENCE   10 (bases 1 to 2030)
  AUTHORS   Kennedy,M.A., Gonzalez-Sarmiento,R., Kees,U.R., Lampert,F.,
            Dear,N., Boehm,T. and Rabbitts,T.H.
  TITLE     HOX11, a homeobox-containing T-cell oncogene on human chromosome
            10q24
  JOURNAL   Proc Natl Acad Sci U S A 88 (20), 8900-8904 (1991)
   PUBMED   1681546
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC170878.4.
            
            On Aug 13, 2009 this sequence version replaced NM_021901.2.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC018246.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849381, SAMN00849383
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-778               AC170878.4         76750-77527
            779-980             AC170878.4         79551-79752
            981-2030            AC170878.4         81929-82978
FEATURES             Location/Qualifiers
     source          1..2030
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="19"
                     /map="19 38.45 cM"
     gene            1..2030
                     /gene="Tlx1"
                     /gene_synonym="Hox-11; Hox11; Tlx-1"
                     /note="T cell leukemia, homeobox 1"
                     /db_xref="GeneID:21908"
                     /db_xref="MGI:MGI:98769"
     exon            1..778
                     /gene="Tlx1"
                     /gene_synonym="Hox-11; Hox11; Tlx-1"
                     /inference="alignment:Splign:2.1.0"
     CDS             202..1203
                     /gene="Tlx1"
                     /gene_synonym="Hox-11; Hox11; Tlx-1"
                     /note="homeobox TLX-1; homeobox protein Hox-11"
                     /codon_start=1
                     /product="T-cell leukemia homeobox protein 1"
                     /protein_id="NP_068701.1"
                     /db_xref="CCDS:CCDS29858.1"
                     /db_xref="GeneID:21908"
                     /db_xref="MGI:MGI:98769"
                     /translation="

MEHLGPHHLHPGHAEPISFGIDQILNSPDQGGCMGPASRLQDGDYGLGCLVGGAYTYGGGGSAAGAGAGGTGAYGAGGPGGPGGPAGGGGGACSMGPLPGSYNVNMALAGGPGPGGGGGGGGAGGAGALSAAGVIRVPAHRPLAGAVAHPQPLATGLPTVPSVPAVPGVNNLTGLTFPWMESNRRYTKDRFTGHPYQNRTPPKKKKPRTSFTRLQICELEKRFHRQKYLASAERAALAKALKMTDAQVKTWFQNRRTKWRRQTAEEREAERQQANRILLQLQQEAFQKSLAQPLPADPLCVHNSSLFALQNLQPWSDDSTKITSVTSVASACE"

     misc_feature    814..984
                     /gene="Tlx1"
                     /gene_synonym="Hox-11; Hox11; Tlx-1"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            779..980
                     /gene="Tlx1"
                     /gene_synonym="Hox-11; Hox11; Tlx-1"
                     /inference="alignment:Splign:2.1.0"
     exon            981..2030
                     /gene="Tlx1"
                     /gene_synonym="Hox-11; Hox11; Tlx-1"
                     /inference="alignment:Splign:2.1.0"
     regulatory      2009..2014
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Tlx1"
                     /gene_synonym="Hox-11; Hox11; Tlx-1"
                     /note="hexamer: AATAAA"
     polyA_site      2030
                     /gene="Tlx1"
                     /gene_synonym="Hox-11; Hox11; Tlx-1"
                     /note="major polyA site"
ORIGIN      

ggaaggagaagccggagaggggaagaatacagctccccctctctccttcccctcccccctactttggcccttctgcgcacttcgccttcaagtctcagcgcagcctggggtggcgattgcctccgcgctccgactcgctgcccgggtagtccagcgcagcgatcgcccgcgcccgggcccccgcgtggggccggggccagcatggagcacctgggtccgcaccatctccacccgggccacgcggagcccatcagcttcggtatcgaccagatcctcaacagccccgaccagggcggctgcatggggcccgcttcgcgcctccaggatggagactacggccttggctgtttggttggaggcgcctacacttacggcggcgggggctccgctgctggggcgggggccgggggcactggcgcttacggcgcgggtggcccaggtggtcctggtggtccggcgggcggcggcggcggtgcctgcagcatgggcccactgcccggctcctacaacgtgaacatggccttggcgggcggccccggtccgggcggcggcggcggtggcgggggtgccggtggcgccggggcgctgagcgctgcaggggtgatccgggtgcccgcgcacaggccgctagctggagctgtggcccatccccagcccctggccaccggcttgcctacagtaccctctgtgcctgcggtgccgggtgtcaacaacctcaccggcctcacctttccctggatggagagtaaccgcagatacacaaaggacaggttcacaggtcacccctatcagaaccggacgccccctaagaagaagaagccgcgcacatccttcacgcgcctgcagatctgtgagctggaaaagcgcttccaccgccagaagtacttggcttcggcggagcgcgctgctctggccaaggcgctcaaaatgaccgatgcgcaagtaaaaacctggttccagaaccggaggacgaaatggaggcgacagacagcagaggaacgtgaggccgagaggcagcaggcgaaccgcatcctcctgcagctgcagcaggaagccttccagaagagcctggcccagccgctgcctgcagacccactgtgcgtgcacaactcctcgctcttcgccctgcagaacctgcagccgtggtctgacgactccaccaaaatcaccagcgtcacgtccgtggcttcggcctgcgagtgaggacccaaggcccgttgaggactttccggagaaccagaactctcgacaccctttctgactgcacgcaggagggaaatggggggcttctcagcaaggctcccaagcaccgcctccactcccctgcggacacttcctgtcttcggtggaagagggctggggatacaggcagagacatcttcccagaagcctgtgtgatcctgccctcactctggaacagttcagaatcctctgttttcctctatttcataaaatttactgatttttaacatgggacagagagacccaaaggaagtagggtccggaaggcttctgggatccccaggcagccatctgtactaaagctggaaacctctctgttcctctcctgggaggagagcccggaggtccacacagaggtgataccactgtccctcctggtgtcacccagagctacacacaggggcctatcgcagagcatcagtgcacacacaggatcacagcaaatgacccttgttgtagggcatagtctggggtgactctcagactcacccaaacagcacggacctcaaacacacggccatagtcacactgtgacacacacaacagctaaacttggtctgtcaggccctcagccacacatcccagcatcacccaggtcacccaggtcacccaggtatgcacagacaggctttcacataaatgcagcccatttctccagatcctgtttggggaggggggtaagttatgcccttataagttatgcgcttataaggtgttttctgtgtaaccattttataaagtgcttgtgtaatttatgtggaaaaataataaaagcctctggatcagga

//