GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-11-05 16:54:39, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_013478               1315 bp    mRNA    linear   ROD 22-JUN-2025
DEFINITION  Mus musculus alpha-2-glycoprotein 1, zinc (Azgp1), mRNA.
ACCESSION   NM_013478
VERSION     NM_013478.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1315)
  AUTHORS   Yang,S., Yin,Y., Sun,Y., Ai,D., Xia,X., Xu,X. and Song,J.
  TITLE     AZGP1 Aggravates Macrophage M1 Polarization and Pyroptosis in
            Periodontitis
  JOURNAL   J Dent Res 103 (6), 631-641 (2024)
   PUBMED   38491721
  REMARK    GeneRIF: AZGP1 Aggravates Macrophage M1 Polarization and Pyroptosis
            in Periodontitis.
REFERENCE   2  (bases 1 to 1315)
  AUTHORS   Wen,R.M., Qiu,Z., Marti,G.E.W., Peterson,E.E., Marques,F.J.G.,
            Bermudez,A., Wei,Y., Nolley,R., Lam,N., Polasko,A.L., Chiu,C.L.,
            Zhang,D., Cho,S., Karageorgos,G.M., McDonough,E., Chadwick,C.,
            Ginty,F., Jung,K.J., Machiraju,R., Mallick,P., Crowley,L.,
            Pollack,J.R., Zhao,H., Pitteri,S.J. and Brooks,J.D.
  TITLE     AZGP1 deficiency promotes angiogenesis in prostate cancer
  JOURNAL   J Transl Med 22 (1), 383 (2024)
   PUBMED   38659028
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1315)
  AUTHORS   Brutsch,S.M., Madzharova,E., Pantasis,S., Wustemann,T., Gurri,S.,
            Steenbock,H., Gazdhar,A., Kuhn,G., Angel,P., Bellusci,S.,
            Brinckmann,J., Auf dem Keller,U., Werner,S. and Bordoli,M.R.
  TITLE     Mesenchyme-derived vertebrate lonesome kinase controls lung
            organogenesis by altering the matrisome
  JOURNAL   Cell Mol Life Sci 80 (4), 89 (2023)
   PUBMED   36920550
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1315)
  AUTHORS   Sun,H., Ma,F., Chen,W. and Yang,X.
  TITLE     Adipokine ZAG Alters Depression-Like Behavior by Regulating
            Oxidative Stress in Hippocampus
  JOURNAL   Horm Metab Res 54 (4), 259-267 (2022)
   PUBMED   35255519
  REMARK    GeneRIF: Adipokine ZAG Alters Depression-Like Behavior by
            Regulating Oxidative Stress in Hippocampus.
REFERENCE   5  (bases 1 to 1315)
  AUTHORS   Fan,G., Li,Y., Ma,F., Zhao,R. and Yang,X.
  TITLE     Zinc-alpha2-glycoprotein promotes skeletal muscle lipid metabolism
            in cold-stressed mice
  JOURNAL   Endocr J 68 (1), 53-62 (2021)
   PUBMED   32863292
  REMARK    GeneRIF: Zinc-alpha2-glycoprotein promotes skeletal muscle lipid
            metabolism in cold-stressed mice.
REFERENCE   6  (bases 1 to 1315)
  AUTHORS   Quaggin,S.E., Heuvel,G.B., Golden,K., Bodmer,R. and Igarashi,P.
  TITLE     Primary structure, neural-specific expression, and chromosomal
            localization of Cux-2, a second murine homeobox gene related to
            Drosophila cut
  JOURNAL   J Biol Chem 271 (37), 22624-22634 (1996)
   PUBMED   8798433
REFERENCE   7  (bases 1 to 1315)
  AUTHORS   Sharma,S., Leonard,J., Lee,S., Chapman,H.D., Leiter,E.H. and
            Montminy,M.R.
  TITLE     Pancreatic islet expression of the homeobox factor STF-1 relies on
            an E-box motif that binds USF
  JOURNAL   J Biol Chem 271 (4), 2294-2299 (1996)
   PUBMED   8567692
REFERENCE   8  (bases 1 to 1315)
  AUTHORS   Takahara,K., Osborne,L., Elliott,R.W., Tsui,L.C., Scherer,S.W. and
            Greenspan,D.S.
  TITLE     Fine mapping of the human and mouse genes for the type I
            procollagen COOH-terminal proteinase enhancer protein
  JOURNAL   Genomics 31 (2), 253-256 (1996)
   PUBMED   8824813
REFERENCE   9  (bases 1 to 1315)
  AUTHORS   Noguchi,M., Kitabatake,A., Ishibashi,T. and Kasahara,M.
  TITLE     The MHC class I-like Zn-alpha 2-glycoprotein gene maps to mouse
            chromosome 5
  JOURNAL   Immunogenetics 42 (1), 72-74 (1995)
   PUBMED   7797272
REFERENCE   10 (bases 1 to 1315)
  AUTHORS   Ueyama,H., Naitoh,H. and Ohkubo,I.
  TITLE     Structure and expression of rat and mouse mRNAs for Zn-alpha
            2-glycoprotein
  JOURNAL   J Biochem 116 (3), 677-681 (1994)
   PUBMED   7852290
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BY101787.1, AK005051.1, BY705112.1 and D18019.1.
            
            On Nov 16, 2007 this sequence version replaced NM_013478.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC061646.1, AK005051.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849381, SAMN00849384
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-15                BY101787.1         1-15
            16-233              AK005051.1         2-219
            234-361             BY705112.1         187-314
            362-1310            AK005051.1         348-1296
            1311-1315           D18019.1           189-193
FEATURES             Location/Qualifiers
     source          1..1315
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="5"
                     /map="5 76.92 cM"
     gene            1..1315
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="alpha-2-glycoprotein 1, zinc"
                     /db_xref="GeneID:12007"
                     /db_xref="MGI:MGI:103163"
     exon            1..100
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    10..12
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="upstream in-frame stop codon"
     CDS             40..963
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="major histocompatibility complex class I-like
                     protein; zn-alpha-2-GP"
                     /codon_start=1
                     /product="zinc-alpha-2-glycoprotein precursor"
                     /protein_id="NP_038506.2"
                     /db_xref="CCDS:CCDS19783.1"
                     /db_xref="GeneID:12007"
                     /db_xref="MGI:MGI:103163"
                     /translation="
MVPVLLSLPLLLGPAVFQETGSYYLTFLYTGLSRPSKGFPRFQATAFLNDQAFFHYNSNSGKAEPVGPWSQVEGMEDWEKESQLQRAREEIFLVTLKDIMDYYKDTTGSHTFQGMFGCEITNNRSSGAVWRYAYDGEDFIEFNKEIPAWIPLDPAAANTKLKWEAEKVYVQRAKAYLEEECPEMLKRYLNYSRSHLDRIDPPTVTITSRVIPGGNRIFKCLAYGFYPQRISLHWNKANKKLAFEPERGVFPNGNGTYLSWAEVEVSPQDIDPFFCLIDHRGFSQSLSVQWDRTRKVKDENNVVAQPQ"
     sig_peptide     40..90
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="/evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (Q64726.2)"
     mat_peptide     91..960
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /product="zinc-alpha-2-glycoprotein"
     misc_feature    91..93
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="Pyrrolidone carboxylic acid.
                     /evidence=ECO:0000250|UniProtKB:P25311; propagated from
                     UniProtKB/Swiss-Prot (Q64726.2);
                     pyrrolidone-carboxylic-acid site"
     misc_feature    100..627
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="Class I Histocompatibility antigen, domains alpha 1
                     and 2; Region: MHC_I; cl08246"
                     /db_xref="CDD:471794"
     misc_feature    406..408
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q64726.2); glycosylation site"
     misc_feature    607..609
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000269|PubMed:17330941; propagated from
                     UniProtKB/Swiss-Prot (Q64726.2); glycosylation site"
     misc_feature    631..909
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    685..699
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    730..744
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    799..801
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q64726.2); glycosylation site"
     misc_feature    820..834
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    853..870
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    898..909
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     exon            101..361
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /inference="alignment:Splign:2.1.0"
     exon            362..637
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /inference="alignment:Splign:2.1.0"
     exon            638..1315
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /inference="alignment:Splign:2.1.0"
     polyA_site      1315
                     /gene="Azgp1"
                     /gene_synonym="Zag"
                     /note="major polyA site"
ORIGIN      
tttcctgtgtagactgttctcccgggcactaccgtagcaatggtgcctgtcctgctgtccctgcctctccttctgggtcctgcagtctttcaggagactgggtcttattatctgacctttctctacaccgggttgtccagacccagcaaaggttttccgaggtttcaagccactgcatttctcaatgaccaggccttcttccactacaacagcaacagcgggaaggcagagcctgtgggaccttggagccaggtggaaggaatggaggactgggagaaggaaagccagcttcagagggccagggaggagatcttccttgtgaccctgaaagacatcatggactattacaaggacactacagggtctcacacctttcagggaatgtttggttgcgagatcacaaataacagaagtagtggagctgtctggaggtatgcctacgacggagaggatttcatcgaattcaacaaagaaatcccagcttggatccccttagacccagcagctgcaaacaccaagctaaagtgggaagcagaaaaggtctacgtgcagcgagccaaggcatacctagaggaggagtgtcctgaaatgctgaagaggtacctgaactacagtcgatctcacctggaccgaatagatcctcccactgtgacaatcaccagccgtgtgatcccaggaggaaacagaatattcaaatgcctggcctatggcttctacccacaaagaattagtctgcactggaacaaggccaacaagaagctagcatttgaaccagaaagaggtgtttttcccaatggaaatggcacttacctctcctgggcagaggtggaagtctccccacaggacatagaccccttcttctgcctcatagatcacagggggttttcccaatctctctcggtgcagtgggataggacaagaaaagtaaaggatgaaaacaatgttgtagctcagcctcagtaagttaccctctctgcctgacatgagagaggtgaacttcagaagtcaatgtcatcaacaaggtcttccatgggccactgtacaacagccagcaagaatccaaggaagaggcatgggcacagaagacttgaatgccacagactgagttcactctcaatgtcagatcaatcgccttgccttgtaaacctcctccttgattaatctgtcaaccctcacaattgccctcatgcctagaacagcacagaaaggaaggcattttaaactcagagatgctagagaagtgtgagttgattttatcatgtattctgcccccacatacttgattcaattgtgaacatcttcatattcactcaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]