ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-07-07 03:31:13, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_013478 1315 bp mRNA linear ROD 22-JUN-2025
DEFINITION Mus musculus alpha-2-glycoprotein 1, zinc (Azgp1), mRNA.
ACCESSION NM_013478
VERSION NM_013478.2
KEYWORDS RefSeq; RefSeq Select.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 1315)
AUTHORS Yang,S., Yin,Y., Sun,Y., Ai,D., Xia,X., Xu,X. and Song,J.
TITLE AZGP1 Aggravates Macrophage M1 Polarization and Pyroptosis in
Periodontitis
JOURNAL J Dent Res 103 (6), 631-641 (2024)
PUBMED 38491721
REMARK GeneRIF: AZGP1 Aggravates Macrophage M1 Polarization and Pyroptosis
in Periodontitis.
REFERENCE 2 (bases 1 to 1315)
AUTHORS Wen,R.M., Qiu,Z., Marti,G.E.W., Peterson,E.E., Marques,F.J.G.,
Bermudez,A., Wei,Y., Nolley,R., Lam,N., Polasko,A.L., Chiu,C.L.,
Zhang,D., Cho,S., Karageorgos,G.M., McDonough,E., Chadwick,C.,
Ginty,F., Jung,K.J., Machiraju,R., Mallick,P., Crowley,L.,
Pollack,J.R., Zhao,H., Pitteri,S.J. and Brooks,J.D.
TITLE AZGP1 deficiency promotes angiogenesis in prostate cancer
JOURNAL J Transl Med 22 (1), 383 (2024)
PUBMED 38659028
REMARK Publication Status: Online-Only
REFERENCE 3 (bases 1 to 1315)
AUTHORS Brutsch,S.M., Madzharova,E., Pantasis,S., Wustemann,T., Gurri,S.,
Steenbock,H., Gazdhar,A., Kuhn,G., Angel,P., Bellusci,S.,
Brinckmann,J., Auf dem Keller,U., Werner,S. and Bordoli,M.R.
TITLE Mesenchyme-derived vertebrate lonesome kinase controls lung
organogenesis by altering the matrisome
JOURNAL Cell Mol Life Sci 80 (4), 89 (2023)
PUBMED 36920550
REMARK Publication Status: Online-Only
REFERENCE 4 (bases 1 to 1315)
AUTHORS Sun,H., Ma,F., Chen,W. and Yang,X.
TITLE Adipokine ZAG Alters Depression-Like Behavior by Regulating
Oxidative Stress in Hippocampus
JOURNAL Horm Metab Res 54 (4), 259-267 (2022)
PUBMED 35255519
REMARK GeneRIF: Adipokine ZAG Alters Depression-Like Behavior by
Regulating Oxidative Stress in Hippocampus.
REFERENCE 5 (bases 1 to 1315)
AUTHORS Fan,G., Li,Y., Ma,F., Zhao,R. and Yang,X.
TITLE Zinc-alpha2-glycoprotein promotes skeletal muscle lipid metabolism
in cold-stressed mice
JOURNAL Endocr J 68 (1), 53-62 (2021)
PUBMED 32863292
REMARK GeneRIF: Zinc-alpha2-glycoprotein promotes skeletal muscle lipid
metabolism in cold-stressed mice.
REFERENCE 6 (bases 1 to 1315)
AUTHORS Quaggin,S.E., Heuvel,G.B., Golden,K., Bodmer,R. and Igarashi,P.
TITLE Primary structure, neural-specific expression, and chromosomal
localization of Cux-2, a second murine homeobox gene related to
Drosophila cut
JOURNAL J Biol Chem 271 (37), 22624-22634 (1996)
PUBMED 8798433
REFERENCE 7 (bases 1 to 1315)
AUTHORS Sharma,S., Leonard,J., Lee,S., Chapman,H.D., Leiter,E.H. and
Montminy,M.R.
TITLE Pancreatic islet expression of the homeobox factor STF-1 relies on
an E-box motif that binds USF
JOURNAL J Biol Chem 271 (4), 2294-2299 (1996)
PUBMED 8567692
REFERENCE 8 (bases 1 to 1315)
AUTHORS Takahara,K., Osborne,L., Elliott,R.W., Tsui,L.C., Scherer,S.W. and
Greenspan,D.S.
TITLE Fine mapping of the human and mouse genes for the type I
procollagen COOH-terminal proteinase enhancer protein
JOURNAL Genomics 31 (2), 253-256 (1996)
PUBMED 8824813
REFERENCE 9 (bases 1 to 1315)
AUTHORS Noguchi,M., Kitabatake,A., Ishibashi,T. and Kasahara,M.
TITLE The MHC class I-like Zn-alpha 2-glycoprotein gene maps to mouse
chromosome 5
JOURNAL Immunogenetics 42 (1), 72-74 (1995)
PUBMED 7797272
REFERENCE 10 (bases 1 to 1315)
AUTHORS Ueyama,H., Naitoh,H. and Ohkubo,I.
TITLE Structure and expression of rat and mouse mRNAs for Zn-alpha
2-glycoprotein
JOURNAL J Biochem 116 (3), 677-681 (1994)
PUBMED 7852290
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BY101787.1, AK005051.1, BY705112.1 and D18019.1.
On Nov 16, 2007 this sequence version replaced NM_013478.1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC061646.1, AK005051.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMN00849381, SAMN00849384
[ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on single protein-coding transcript
##RefSeq-Attributes-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-15 BY101787.1 1-15
16-233 AK005051.1 2-219
234-361 BY705112.1 187-314
362-1310 AK005051.1 348-1296
1311-1315 D18019.1 189-193
FEATURES Location/Qualifiers
source 1..1315
/organism="Mus musculus"
/mol_type="mRNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="5"
/map="5 76.92 cM"
gene 1..1315
/gene="Azgp1"
/gene_synonym="Zag"
/note="alpha-2-glycoprotein 1, zinc"
/db_xref="GeneID:12007"
/db_xref="MGI:MGI:103163"
exon 1..100
/gene="Azgp1"
/gene_synonym="Zag"
/inference="alignment:Splign:2.1.0"
misc_feature 10..12
/gene="Azgp1"
/gene_synonym="Zag"
/note="upstream in-frame stop codon"
CDS 40..963
/gene="Azgp1"
/gene_synonym="Zag"
/note="major histocompatibility complex class I-like
protein; zn-alpha-2-GP"
/codon_start=1
/product="zinc-alpha-2-glycoprotein precursor"
/protein_id="NP_038506.2"
/db_xref="CCDS:CCDS19783.1"
/db_xref="GeneID:12007"
/db_xref="MGI:MGI:103163"
/translation="
MVPVLLSLPLLLGPAVFQETGSYYLTFLYTGLSRPSKGFPRFQATAFLNDQAFFHYNSNSGKAEPVGPWSQVEGMEDWEKESQLQRAREEIFLVTLKDIMDYYKDTTGSHTFQGMFGCEITNNRSSGAVWRYAYDGEDFIEFNKEIPAWIPLDPAAANTKLKWEAEKVYVQRAKAYLEEECPEMLKRYLNYSRSHLDRIDPPTVTITSRVIPGGNRIFKCLAYGFYPQRISLHWNKANKKLAFEPERGVFPNGNGTYLSWAEVEVSPQDIDPFFCLIDHRGFSQSLSVQWDRTRKVKDENNVVAQPQ"
sig_peptide 40..90
/gene="Azgp1"
/gene_synonym="Zag"
/note="/evidence=ECO:0000250; propagated from
UniProtKB/Swiss-Prot (Q64726.2)"
mat_peptide 91..960
/gene="Azgp1"
/gene_synonym="Zag"
/product="zinc-alpha-2-glycoprotein"
misc_feature 91..93
/gene="Azgp1"
/gene_synonym="Zag"
/note="Pyrrolidone carboxylic acid.
/evidence=ECO:0000250|UniProtKB:P25311; propagated from
UniProtKB/Swiss-Prot (Q64726.2);
pyrrolidone-carboxylic-acid site"
misc_feature 100..627
/gene="Azgp1"
/gene_synonym="Zag"
/note="Class I Histocompatibility antigen, domains alpha 1
and 2; Region: MHC_I; cl08246"
/db_xref="CDD:471794"
misc_feature 406..408
/gene="Azgp1"
/gene_synonym="Zag"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q64726.2); glycosylation site"
misc_feature 607..609
/gene="Azgp1"
/gene_synonym="Zag"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000269|PubMed:17330941; propagated from
UniProtKB/Swiss-Prot (Q64726.2); glycosylation site"
misc_feature 631..909
/gene="Azgp1"
/gene_synonym="Zag"
/note="Immunoglobulin domain; Region: Ig; cl11960"
/db_xref="CDD:472250"
misc_feature 685..699
/gene="Azgp1"
/gene_synonym="Zag"
/note="Ig strand B [structural motif]; Region: Ig strand
B"
/db_xref="CDD:409353"
misc_feature 730..744
/gene="Azgp1"
/gene_synonym="Zag"
/note="Ig strand C [structural motif]; Region: Ig strand
C"
/db_xref="CDD:409353"
misc_feature 799..801
/gene="Azgp1"
/gene_synonym="Zag"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q64726.2); glycosylation site"
misc_feature 820..834
/gene="Azgp1"
/gene_synonym="Zag"
/note="Ig strand E [structural motif]; Region: Ig strand
E"
/db_xref="CDD:409353"
misc_feature 853..870
/gene="Azgp1"
/gene_synonym="Zag"
/note="Ig strand F [structural motif]; Region: Ig strand
F"
/db_xref="CDD:409353"
misc_feature 898..909
/gene="Azgp1"
/gene_synonym="Zag"
/note="Ig strand G [structural motif]; Region: Ig strand
G"
/db_xref="CDD:409353"
exon 101..361
/gene="Azgp1"
/gene_synonym="Zag"
/inference="alignment:Splign:2.1.0"
exon 362..637
/gene="Azgp1"
/gene_synonym="Zag"
/inference="alignment:Splign:2.1.0"
exon 638..1315
/gene="Azgp1"
/gene_synonym="Zag"
/inference="alignment:Splign:2.1.0"
polyA_site 1315
/gene="Azgp1"
/gene_synonym="Zag"
/note="major polyA site"
ORIGIN
tttcctgtgtagactgttctcccgggcactaccgtagcaatggtgcctgtcctgctgtccctgcctctccttctgggtcctgcagtctttcaggagactgggtcttattatctgacctttctctacaccgggttgtccagacccagcaaaggttttccgaggtttcaagccactgcatttctcaatgaccaggccttcttccactacaacagcaacagcgggaaggcagagcctgtgggaccttggagccaggtggaaggaatggaggactgggagaaggaaagccagcttcagagggccagggaggagatcttccttgtgaccctgaaagacatcatggactattacaaggacactacagggtctcacacctttcagggaatgtttggttgcgagatcacaaataacagaagtagtggagctgtctggaggtatgcctacgacggagaggatttcatcgaattcaacaaagaaatcccagcttggatccccttagacccagcagctgcaaacaccaagctaaagtgggaagcagaaaaggtctacgtgcagcgagccaaggcatacctagaggaggagtgtcctgaaatgctgaagaggtacctgaactacagtcgatctcacctggaccgaatagatcctcccactgtgacaatcaccagccgtgtgatcccaggaggaaacagaatattcaaatgcctggcctatggcttctacccacaaagaattagtctgcactggaacaaggccaacaagaagctagcatttgaaccagaaagaggtgtttttcccaatggaaatggcacttacctctcctgggcagaggtggaagtctccccacaggacatagaccccttcttctgcctcatagatcacagggggttttcccaatctctctcggtgcagtgggataggacaagaaaagtaaaggatgaaaacaatgttgtagctcagcctcagtaagttaccctctctgcctgacatgagagaggtgaacttcagaagtcaatgtcatcaacaaggtcttccatgggccactgtacaacagccagcaagaatccaaggaagaggcatgggcacagaagacttgaatgccacagactgagttcactctcaatgtcagatcaatcgccttgccttgtaaacctcctccttgattaatctgtcaaccctcacaattgccctcatgcctagaacagcacagaaaggaaggcattttaaactcagagatgctagagaagtgtgagttgattttatcatgtattctgcccccacatacttgattcaattgtgaacatcttcatattcactcaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]