LOCUS       NM_010468               2902 bp    mRNA    linear   ROD 02-JUN-2024
DEFINITION  Mus musculus homeobox D3 (Hoxd3), mRNA.
ACCESSION   NM_010468
VERSION     NM_010468.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 2902)
  AUTHORS   Hintermann,A., Guerreiro,I., Lopez-Delisle,L., Bolt,C.C., Gitto,S.,
            Duboule,D. and Beccari,L.
  TITLE     Developmental and evolutionary comparative analysis of a regulatory
            landscape in mouse and chicken
  JOURNAL   Development 149 (12) (2022)
   PUBMED   35770682
REFERENCE   2  (bases 1 to 2902)
  AUTHORS   Zhang,M., Du,S., Ou,H., Cui,R., Jiang,N., Lin,Y., Ge,R., Ma,D. and
            Zhang,J.
  TITLE     Ablation of Zfhx4 results in early postnatal lethality by
            disrupting the respiratory center in mice
  JOURNAL   J Mol Cell Biol 13 (3), 210-224 (2021)
   PUBMED   33475140
REFERENCE   3  (bases 1 to 2902)
  AUTHORS   Lopez-Delgado,A.C., Delgado,I., Cadenas,V., Sanchez-Cabo,F. and
            Torres,M.
  TITLE     Axial skeleton anterior-posterior patterning is regulated through
            feedback regulation between Meis transcription factors and retinoic
            acid
  JOURNAL   Development 148 (1) (2021)
   PUBMED   33298461
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 2902)
  AUTHORS   Higashijima,Y., Nagai,N., Yamamoto,M., Kitazawa,T., Kawamura,Y.K.,
            Taguchi,A., Nakada,N., Nangaku,M., Furukawa,T., Aburatani,H.,
            Kurihara,H., Wada,Y. and Kanki,Y.
  TITLE     Lysine demethylase 7a regulates murine anterior-posterior
            development by modulating the transcription of Hox gene cluster
  JOURNAL   Commun Biol 3 (1), 725 (2020)
   PUBMED   33257809
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2902)
  AUTHORS   Sato,T., Kataoka,K., Ito,Y., Yokoyama,S., Inui,M., Mori,M.,
            Takahashi,S., Akita,K., Takada,S., Ueno-Kudoh,H. and Asahara,H.
  TITLE     Lin28a/let-7 pathway modulates the Hox code via Polycomb regulation
            during axial patterning in vertebrates
  JOURNAL   Elife 9, e53608 (2020)
   PUBMED   32479258
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2902)
  AUTHORS   Scott,M.P.
  TITLE     Vertebrate homeobox gene nomenclature
  JOURNAL   Cell 71 (4), 551-553 (1992)
   PUBMED   1358459
REFERENCE   7  (bases 1 to 2902)
  AUTHORS   Orr-Urtreger,A., Bedford,M.T., Do,M.S., Eisenbach,L. and Lonai,P.
  TITLE     Developmental expression of the alpha receptor for platelet-derived
            growth factor, which is deleted in the embryonic lethal Patch
            mutation
  JOURNAL   Development 115 (1), 289-303 (1992)
   PUBMED   1322271
REFERENCE   8  (bases 1 to 2902)
  AUTHORS   Singh,G., Kaur,S., Stock,J.L., Jenkins,N.A., Gilbert,D.J.,
            Copeland,N.G. and Potter,S.S.
  TITLE     Identification of 10 murine homeobox genes
  JOURNAL   Proc Natl Acad Sci U S A 88 (23), 10706-10710 (1991)
   PUBMED   1683707
REFERENCE   9  (bases 1 to 2902)
  AUTHORS   Hunt,P., Gulisano,M., Cook,M., Sham,M.H., Faiella,A., Wilkinson,D.,
            Boncinelli,E. and Krumlauf,R.
  TITLE     A distinct Hox code for the branchial region of the vertebrate head
  JOURNAL   Nature 353 (6347), 861-864 (1991)
   PUBMED   1682814
REFERENCE   10 (bases 1 to 2902)
  AUTHORS   Siracusa,L.D., Alvord,W.G., Bickmore,W.A., Jenkins,N.A. and
            Copeland,N.G.
  TITLE     Interspecific backcross mice show sex-specific differences in
            allelic inheritance
  JOURNAL   Genetics 128 (4), 813-821 (1991)
   PUBMED   1916246
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK138525.1 and AK133705.1.
            
            On Mar 2, 2007 this sequence version replaced NM_010468.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK138525.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01164133, SAMN01164138
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2036              AK138525.1         2-2037
            2037-2546           AK133705.1         1905-2414
            2547-2902           AK138525.1         2548-2903
FEATURES             Location/Qualifiers
     source          1..2902
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="2"
                     /map="2 44.13 cM"
     gene            1..2902
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /note="homeobox D3"
                     /db_xref="GeneID:15434"
                     /db_xref="MGI:MGI:96207"
     exon            1..324
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /inference="alignment:Splign:2.1.0"
     exon            325..952
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    403..405
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /note="upstream in-frame stop codon"
     CDS             409..1710
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /note="homeo box D4; homeobox protein MH-19; homeobox
                     protein Hox-4.1; homeo box D3"
                     /codon_start=1
                     /product="homeobox protein Hox-D3"
                     /protein_id="NP_034598.2"
                     /db_xref="CCDS:CCDS38149.1"
                     /db_xref="GeneID:15434"
                     /db_xref="MGI:MGI:96207"
                     /translation="

MLFEQGQLTLELPECTMQKAAYYENPGLFGGYGYSKATDTYGYSTPHQPYPPPAAANSLDSDYPSSACSIQSSAPLRAPAHKGAELNGSCMRPGTGNSQGGGGGNQPPGLNSEQQPPQPPPPPPPTLPPSSPTNPGSGVPAKKTKGGLSASSSSSTISKQIFPWMKESRQNSKQKNSCATSGENCEDKSPPGPASKRVRTAYTSAQLVELEKEFHFNRYLCRPRRVEMANLLNLTERQIKIWFQNRRMKYKKDQKAKGILHSPAGQSPERSPPLGGAAGHVAYSGQLPPVPGLAYDAPSPPAFAKSQPNMYGLAAYTAPLSSCLPQQKRYPAPEFEPHPMASNGGGFASANLQGSPVYVGGNFVDSMAPTSGPVFNLGHLSHPSSASVDYSCAAQIPGNHHHGPCDPHPTYTDLSAHHSSQGRLPEAPKLTHL"

     misc_feature    538..1002
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /note="propagated from UniProtKB/Swiss-Prot (P09027.4);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    889..906
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /note="propagated from UniProtKB/Swiss-Prot (P09027.4);
                     Region: Antp-type hexapeptide"
     misc_feature    994..1164
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    1180..1248
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /note="propagated from UniProtKB/Swiss-Prot (P09027.4);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1516..1701
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /note="Domain of unknown function (DUF4074); Region:
                     DUF4074; pfam13293"
                     /db_xref="CDD:463833"
     misc_feature    1609..1707
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /note="propagated from UniProtKB/Swiss-Prot (P09027.4);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            953..2902
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /inference="alignment:Splign:2.1.0"
     regulatory      2525..2530
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /note="hexamer: AATAAA"
     polyA_site      2549
                     /gene="Hoxd3"
                     /gene_synonym="Hox-4.1; Hox-5.5"
                     /note="major polyA site"
ORIGIN      

ctagtcgccggctgcgggatcgcgtggtccgcagcggcctgggctcccgccgcgactccaccgcagctcgcccccggtcgcgattgcggccgcttccagagccggcggggagcccggaaggagccccgggcgccgagccaccagccgcctctcacactccagcagggagccgaccgcctgcttcaaccctggtcccgagcttcctacccgatccctccagcaacatgagcccaaacctgccgaggatggtgagcgcagccgggcagcgccggatggattccagccacagtccgggccgaccgcccgcagttcggcaccctccgggttacctggagcctgagagctggcccagctctctcaagattcagcagacattggccttggaggagaaggagaccgtggtagtcaatgttatttgagcagggtcagctgaccctggaacttcctgagtgcaccatgcagaaggctgcatactacgagaacccaggactctttggaggctacggatatagcaaagccactgacacatatggctacagcactcctcatcagccttacccaccccctgctgctgccaactccctggacagtgattacccaagttctgcctgctccatccagagctctgcacctctccgagccccagcccacaaaggagctgaactcaatggtagctgtatgagacctggcactgggaatagccagggtggaggtggtggcaaccaaccccctggtctgaactcagagcagcagccaccacaacctcctcctccaccaccacccaccttgcccccatcttcacctaccaatcctggaagtggagtgcctgccaagaagaccaagggtggactcagtgcttctagctcttcatccaccatcagcaaacagatcttcccctggatgaaagaatcccgacagaactccaagcagaagaacagctgtgccacttcaggagagaactgtgaggacaagagcccacccggcccagcatccaagagggtgcgcacggcgtacacgagtgctcagctggtggagctggagaaggagttccacttcaaccgctatctgtgccggccgcgccgcgtggagatggccaacctgctgaacctcaccgaacgccagatcaagatctggttccagaaccgtcgcatgaagtacaagaaggaccagaaggctaagggcatcctgcattctccagccggtcagtccccggagcgcagcccacctcttggaggagcggcgggccacgtggcttactccggccagctgccgccggtgcccggcctggcctacgacgcaccctcgccgcccgctttcgccaaatcgcagcccaatatgtacggcctggccgcctacacggcgccgctcagcagctgcctgcctcagcagaagcggtacccggcgcccgagttcgagcctcaccccatggcgagcaacggcggcggcttcgccagcgccaacctgcagggcagcccggtgtacgtgggcggcaacttcgtcgactccatggcgcccacgtccgggccggtcttcaatctgggccacctctcgcacccgtcttcggccagcgtggactacagttgcgccgcgcaaatccctggcaaccatcaccacggaccctgcgaccctcatcccacctacacagatctctcggctcaccactcgtctcagggacgcctgcccgaggcccccaaactgacacatctgtagctgttgccgccggccaggcgcaattacctctctggttttggtggcagaggtggtggtggggcggggcggggcccgaggggcagtttaggggatccccctccctgatctggcctggcggatgcctcacgagtggcttccagcggccagggctgacgcgactgggcctccctccaggcgcgtcctcctttgggtgactcgccataaatcagccgcaaggatcctccccagtaaacctgacagtgccataaactgcggaccgagggactctaatctggtaatggtgtccctaaggtaagtcctcgacccatccgtggcgagtcctgaagagggactagggcctggagaaccctgggcctggcccttctgtctagcttagtttcagagaccttaatttataatgctccgtcccctcctgtaaagattgcatcggactaaacaatctgtatttattatttgaagcgagtaatttcgtttccctgattatttatcctcgtcttaatgtatttatgtgtatatttgtagaattctgaggctgggcctaggtacacgctcccaggccttgggggggccacttttcacctctttagtccccttggtctgaactagttgagaggatagttttgaacagttgtaaccatggctggtgtctgtagttgatgttaaaggattgagatcacaaatggtccttcatgggtagagtcaggcagcccggtggcaggactcacgctagtcgtttctcaacagccgaagccctcaccactcgacacagcttattgatttcaaattgtctggtactatttgaacaaacatttagaataaaacctttttttcagttggaagtgtatctgtgttaatcgcacacatctgcaagcagatcactctgtcttcatccctctgtatgatcccgggttgggggaaaaggaccctctgaaacattttatttattcggaacctattgcacaaaattggcgtggagaaatacttgattacatttaagctcttaaaactgagcggcagtaattggaggatgcaaactcgatatcacctaagtggggggcagtcgcaataggattttgccagagcagcgcctgcatgctctttctatacatgatcgtcacatgggcgggtgtgtgttcattttttctgcattaaataataaaaaaataaactttggggaaaaaccctgacaatc

//