LOCUS       NM_010057               1128 bp    mRNA    linear   ROD 15-JUN-2024
DEFINITION  Mus musculus distal-less homeobox 6 (Dlx6), mRNA.
ACCESSION   NM_010057
VERSION     NM_010057.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1128)
  AUTHORS   Cheffer,A., Garcia-Miralles,M., Maier,E., Akol,I., Franz,H.,
            Srinivasan,V.S.V. and Vogel,T.
  TITLE     DOT1L deletion impairs the development of cortical
            parvalbumin-expressing interneurons
  JOURNAL   Cereb Cortex 33 (19), 10272-10285 (2023)
   PUBMED   37566909
REFERENCE   2  (bases 1 to 1128)
  AUTHORS   Kurihara,Y., Ekimoto,T., Gordon,C.T., Uchijima,Y., Sugiyama,R.,
            Kitazawa,T., Iwase,A., Kotani,R., Asai,R., Pingault,V.,
            Ikeguchi,M., Amiel,J. and Kurihara,H.
  TITLE     Mandibulofacial dysostosis with alopecia results from ETAR
            gain-of-function mutations via allosteric effects on ligand binding
  JOURNAL   J Clin Invest 133 (4), e151536 (2023)
   PUBMED   36637912
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1128)
  AUTHORS   Mullen,R.D., Bellessort,B., Levi,G. and Behringer,R.R.
  TITLE     Distal-less homeobox genes Dlx5/6 regulate Mullerian duct
            regression
  JOURNAL   Front Endocrinol (Lausanne) 13, 916173 (2022)
   PUBMED   35909540
  REMARK    GeneRIF: Distal-less homeobox genes Dlx5/6 regulate Mullerian duct
            regression.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1128)
  AUTHORS   Gu,R., Zhang,S., Saha,S.K., Ji,Y., Reynolds,K., McMahon,M., Sun,B.,
            Islam,M., Trainor,P.A., Chen,Y., Xu,Y., Chai,Y., Burkart-Waco,D.
            and Zhou,C.J.
  TITLE     Single-cell transcriptomic signatures and gene regulatory networks
            modulated by Wls in mammalian midline facial formation and clefts
  JOURNAL   Development 149 (14) (2022)
   PUBMED   35781558
REFERENCE   5  (bases 1 to 1128)
  AUTHORS   Aouci,R., El Soudany,M., Maakoul,Z., Fontaine,A., Kurihara,H.,
            Levi,G. and Narboux-Neme,N.
  TITLE     Dlx5/6 Expression Levels in Mouse GABAergic Neurons Regulate Adult
            Parvalbumin Neuronal Density and Anxiety/Compulsive Behaviours
  JOURNAL   Cells 11 (11), 1739 (2022)
   PUBMED   35681437
  REMARK    GeneRIF: Dlx5/6 Expression Levels in Mouse GABAergic Neurons
            Regulate Adult Parvalbumin Neuronal Density and Anxiety/Compulsive
            Behaviours.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1128)
  AUTHORS   Anderson,S.A., Qiu,M., Bulfone,A., Eisenstat,D.D., Meneses,J.,
            Pedersen,R. and Rubenstein,J.L.
  TITLE     Mutations of the homeobox genes Dlx-1 and Dlx-2 disrupt the
            striatal subventricular zone and differentiation of late born
            striatal neurons
  JOURNAL   Neuron 19 (1), 27-37 (1997)
   PUBMED   9247261
REFERENCE   7  (bases 1 to 1128)
  AUTHORS   Qiu,M., Bulfone,A., Ghattas,I., Meneses,J.J., Christensen,L.,
            Sharpe,P.T., Presley,R., Pedersen,R.A. and Rubenstein,J.L.
  TITLE     Role of the Dlx homeobox genes in proximodistal patterning of the
            branchial arches: mutations of Dlx-1, Dlx-2, and Dlx-1 and -2 alter
            morphogenesis of proximal skeletal and soft tissue structures
            derived from the first and second arches
  JOURNAL   Dev Biol 185 (2), 165-184 (1997)
   PUBMED   9187081
REFERENCE   8  (bases 1 to 1128)
  AUTHORS   Stock,D.W., Ellies,D.L., Zhao,Z., Ekker,M., Ruddle,F.H. and
            Weiss,K.M.
  TITLE     The evolution of the vertebrate Dlx gene family
  JOURNAL   Proc Natl Acad Sci U S A 93 (20), 10858-10863 (1996)
   PUBMED   8855272
REFERENCE   9  (bases 1 to 1128)
  AUTHORS   Chen,X., Li,X., Wang,W. and Lufkin,T.
  TITLE     Dlx5 and Dlx6: an evolutionary conserved pair of murine homeobox
            genes expressed in the embryonic skeleton
  JOURNAL   Ann N Y Acad Sci 785, 38-47 (1996)
   PUBMED   8702182
REFERENCE   10 (bases 1 to 1128)
  AUTHORS   Simeone,A., Acampora,D., Pannese,M., D'Esposito,M., Stornaiuolo,A.,
            Gulisano,M., Mallamaci,A., Kastury,K., Druck,T., Huebner,K. et al.
  TITLE     Cloning and characterization of two members of the vertebrate Dlx
            gene family
  JOURNAL   Proc Natl Acad Sci U S A 91 (6), 2250-2254 (1994)
   PUBMED   7907794
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC122240.4.
            
            On Jan 19, 2024 this sequence version replaced NM_010057.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF022078.1, SRR1660815.392232.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849382
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-556               AC122240.4         106507-107062
            557-750             AC122240.4         108313-108506
            751-1039            AC122240.4         110276-110564
            1040-1128           AC122240.4         111112-111200
FEATURES             Location/Qualifiers
     source          1..1128
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="6"
                     /map="6 2.83 cM"
     gene            1..1128
                     /gene="Dlx6"
                     /note="distal-less homeobox 6"
                     /db_xref="GeneID:13396"
                     /db_xref="MGI:MGI:101927"
     exon            1..556
                     /gene="Dlx6"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    64..66
                     /gene="Dlx6"
                     /note="upstream in-frame stop codon"
     CDS             109..1002
                     /gene="Dlx6"
                     /codon_start=1
                     /product="homeobox protein DLX-6"
                     /protein_id="NP_034187.1"
                     /db_xref="CCDS:CCDS51719.1"
                     /db_xref="GeneID:13396"
                     /db_xref="MGI:MGI:101927"
                     /translation="

MMTMTTMADGLEGQDSSKSAFMEFGQQQQQQQQQQQQQQQQQQQQQQPPPPPPPPPPQPHSQQTSPAMAGAHYPLHCLHSAAAAAAAAGSHHHHHQHHHHGSPYASSGGNSYNHRSLAAYPYMSHSQHSPYLQSYHNSSAAAQTRGDDTDQQKTTVIENGEIRFNGKGKKIRKPRTIYSSLQLQALNHRFQQTQYLALPERAELAASLGLTQTQVKIWFQNKRSKFKKLLKQGSNPHESDPLPGSAALSPRSPALPPVWDVSASAKGVSMPPNSYMPGYSHWYSSPHQDTMQRPQMM"

     misc_feature    475..945
                     /gene="Dlx6"
                     /note="Homeodomain-containing transcription factor
                     [Transcription]; Region: COG5576"
                     /db_xref="CDD:227863"
     misc_feature    622..792
                     /gene="Dlx6"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            557..750
                     /gene="Dlx6"
                     /inference="alignment:Splign:2.1.0"
     exon            751..1039
                     /gene="Dlx6"
                     /inference="alignment:Splign:2.1.0"
     exon            1040..1128
                     /gene="Dlx6"
                     /inference="alignment:Splign:2.1.0"
     regulatory      1109..1114
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Dlx6"
                     /note="hexamer: ATTACA"
     polyA_site      1128
                     /gene="Dlx6"
                     /note="major polyA site"
ORIGIN      

caaggatcccgggagctaaggtggctgcaaaggggagagcggtgcgagccaagtgggggagggtgaaagaaacccgggagaaggctttctccagcccccaaagttttgatgatgaccatgactacgatggctgacggcttggaaggccaggactcgtccaaatccgccttcatggagttcgggcagcagcaacagcagcagcagcaacaacagcagcagcaacagcagcagcagcagcagcaacagcagccgccgccgccgccaccgccgccgccgccgcagccgcactcgcagcagacctccccggccatggcaggcgcacattaccctctgcactgcttgcactcggccgcggcggcggcggcggcggccggctcccaccatcaccaccaccagcaccaccaccacggctcgccctacgcgtcgagcggaggcaactcctacaaccaccgatcgctcgccgcctacccctacatgagccactcgcagcacagcccttacctccagtcctaccacaacagcagcgcggccgcccagacgcgcggggacgacacagatcaacaaaaaacgacagtgatcgaaaacggggaaatcaggttcaacggaaaggggaaaaagattcggaagcctcggaccatttattccagcctgcagctccaggctttaaaccatcgctttcagcagactcaatacctggcccttcccgagagagccgaactggctgcttccttaggactgacacaaacacaggtgaagatatggtttcagaataagcgctctaagtttaagaaattgctgaagcagggtagtaacccacacgagagtgaccccctcccgggttcagcagccctgtcaccacgatcaccagccctgcctccagtgtgggacgtttctgcctctgccaagggcgtcagtatgcctcccaacagctacatgccggggtattcacactggtattcctcaccacaccaggacaccatgcagagaccacagatgatgtgacttctctgagtgaacgcctacggagcttctgaaggagacattctccaccggcagaagaatctgcacaaacatggcagcatttttacttgtttaatgagtttaagacattacatgataaaaaacaaa

//