2024-05-06 06:31:09, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_009116 1152 bp mRNA linear ROD 28-MAY-2023 DEFINITION Mus musculus paired related homeobox 2 (Prrx2), mRNA. ACCESSION NM_009116 XM_979268 VERSION NM_009116.3 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1152) AUTHORS Li Y, Wang X, Pan C, Yuan H, Li X, Chen Z and He H. TITLE Myoblast-derived exosomal Prrx2 attenuates osteoporosis via transcriptional regulation of lncRNA-MIR22HG to activate Hippo pathway JOURNAL Mol Med 29 (1), 54 (2023) PUBMED 37081396 REMARK GeneRIF: Myoblast-derived exosomal Prrx2 attenuates osteoporosis via transcriptional regulation of lncRNA-MIR22HG to activate Hippo pathway. Publication Status: Online-Only REFERENCE 2 (bases 1 to 1152) AUTHORS Jang YS, Lee YS, Kim DH, Oh GT, Jeon WK and Han JS. TITLE Peroxiredoxin 2 deletion impairs hippocampal-dependent memory via exacerbating transient ischemia-induced oxidative damage JOURNAL Brain Res Bull 184, 99-105 (2022) PUBMED 35452748 REMARK GeneRIF: Peroxiredoxin 2 deletion impairs hippocampal-dependent memory via exacerbating transient ischemia-induced oxidative damage. REFERENCE 3 (bases 1 to 1152) AUTHORS Gamart J, Barozzi I, Laurent F, Reinhardt R, Martins LR, Oberholzer T, Visel A, Zeller R and Zuniga A. TITLE SMAD4 target genes are part of a transcriptional network that integrates the response to BMP and SHH signaling during early limb bud patterning JOURNAL Development 148 (23) (2021) PUBMED 34822715 REFERENCE 4 (bases 1 to 1152) AUTHORS Yin Y, Haller ME, Chadchan SB, Kommagani R and Ma L. TITLE Signaling through retinoic acid receptors is essential for mammalian uterine receptivity and decidualization JOURNAL JCI Insight 6 (17), e150254 (2021) PUBMED 34292881 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 1152) AUTHORS Funada K, Yoshizaki K, MIyazaki K, Han X, Yuta T, Tian T, Mizuta K, Fu Y, Iwamoto T, Yamada A, Takahashi I and Fukumoto S. TITLE microRNA-875-5p plays critical role for mesenchymal condensation in epithelial-mesenchymal interaction during tooth development JOURNAL Sci Rep 10 (1), 4918 (2020) PUBMED 32188878 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 1152) AUTHORS Leussink B, Brouwer A, el Khattabi M, Poelmann RE, Gittenberger-de Groot AC and Meijlink F. TITLE Expression patterns of the paired-related homeobox genes MHox/Prx1 and S8/Prx2 suggest roles in development of the heart and the forebrain JOURNAL Mech Dev 52 (1), 51-64 (1995) PUBMED 7577675 REFERENCE 7 (bases 1 to 1152) AUTHORS de Jong R and Meijlink F. TITLE The homeobox gene S8: mesoderm-specific expression in presomite embryos and in cells cultured in vitro and modulation in differentiating pluripotent cells JOURNAL Dev Biol 157 (1), 133-146 (1993) PUBMED 7683282 REFERENCE 8 (bases 1 to 1152) AUTHORS Haas IG, Simon-Chazottes D and Guenet JL. TITLE The gene coding for the immunoglobulin heavy chain binding protein BiP (Hsce-70) maps to mouse chromosome 2 JOURNAL Mamm Genome 3 (11), 659-660 (1992) PUBMED 1450517 REFERENCE 9 (bases 1 to 1152) AUTHORS Opstelten DJ, Vogels R, Robert B, Kalkhoven E, Zwartkruis F, de Laaf L, Destree OH, Deschamps J, Lawson KA and Meijlink F. TITLE The mouse homeobox gene, S8, is expressed during embryogenesis predominantly in mesenchyme JOURNAL Mech Dev 34 (1), 29-41 (1991) PUBMED 1680375 REFERENCE 10 (bases 1 to 1152) AUTHORS Kongsuwan K, Webb E, Housiaux P and Adams JM. TITLE Expression of multiple homeobox genes within diverse mammalian haemopoietic lineages JOURNAL EMBO J 7 (7), 2131-2138 (1988) PUBMED 2901346 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL844532.18. On Dec 22, 2022 this sequence version replaced NM_009116.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X52875.1, BC137874.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849374, SAMN00849375 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression ##RefSeq-Attributes-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-338 AL844532.18 76355-76692 339-520 AL844532.18 109421-109602 521-699 AL844532.18 110503-110681 700-1152 AL844532.18 111806-112258 FEATURES Location/Qualifiers source 1..1152 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="2" /map="2 21.74 cM" gene 1..1152 /gene="Prrx2" /gene_synonym="Prx2; S8" /note="paired related homeobox 2" /db_xref="GeneID:20204" /db_xref="MGI:MGI:98218" exon 1..338 /gene="Prrx2" /gene_synonym="Prx2; S8" /inference="alignment:Splign:2.1.0" misc_feature 47..49 /gene="Prrx2" /gene_synonym="Prx2; S8" /note="upstream in-frame stop codon" CDS 92..835 /gene="Prrx2" /gene_synonym="Prx2; S8" /note="PRX-2; homeobox protein S8; homeo box of paired rule; surface antigen, homeo box of paired rule" /codon_start=1 /product="paired mesoderm homeobox protein 2" /protein_id="NP_033142.2" /db_xref="CCDS:CCDS15888.1" /db_xref="GeneID:20204" /db_xref="MGI:MGI:98218" /translation="
MDSAAAAFALDPPAPGPGPPPAPGDCAQARKNFSVSHLLDLEEVAAAGRRAAGPVSGPAEAREGAAREPSGGSSGSEAAPQDGDCPSPGRGTKRKKKQRRNRTTFNSSQLQALERVFERTHYPDAFVREELARRVNLSEARVQVWFQNRRAKFRRNERAMLATRSASLLKSYGQEAAIEQPVAPRPTTMSPDYLSWPASSPYSSVPPYSPGGSSPATPGVNMANSIASLRLKAKEFSLHHSQVPTVN"
misc_feature 92..184 /gene="Prrx2" /gene_synonym="Prx2; S8" /note="propagated from UniProtKB/Swiss-Prot (Q06348.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 236..412 /gene="Prrx2" /gene_synonym="Prx2; S8" /note="propagated from UniProtKB/Swiss-Prot (Q06348.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 398..553 /gene="Prrx2" /gene_synonym="Prx2; S8" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(401..403,521..523,530..535,542..544) /gene="Prrx2" /gene_synonym="Prx2; S8" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature <416..730 /gene="Prrx2" /gene_synonym="Prx2; S8" /note="Homeodomain-containing transcription factor [Transcription]; Region: COG5576" /db_xref="CDD:227863" misc_feature 752..802 /gene="Prrx2" /gene_synonym="Prx2; S8" /note="OAR domain; Region: OAR; pfam03826" /db_xref="CDD:427530" misc_feature 761..802 /gene="Prrx2" /gene_synonym="Prx2; S8" /note="propagated from UniProtKB/Swiss-Prot (Q06348.2); Region: OAR. /evidence=ECO:0000255|PROSITE-ProRule:PRU00138" exon 339..520 /gene="Prrx2" /gene_synonym="Prx2; S8" /inference="alignment:Splign:2.1.0" exon 521..699 /gene="Prrx2" /gene_synonym="Prx2; S8" /inference="alignment:Splign:2.1.0" exon 700..1152 /gene="Prrx2" /gene_synonym="Prx2; S8" /inference="alignment:Splign:2.1.0" misc_feature 755..802 /gene="Prrx2" /gene_synonym="Prx2; S8" /note="aristaless-domain" ORIGIN
gcagaaagttcgggtccccgaccgactgacttgagatccggcacagtgagcagcgggaggcggcggcggccggcagaggcgcggccagggcatggacagcgcggccgccgccttcgccctagacccgccagcgcccggcccggggcccccgcccgcacccggcgattgcgcccaggcgcgcaagaacttctcggtgagccacctcctggacctggaggaggtggcggctgctgggcgcagggctgcggggcccgtttcggggcccgccgaggcgcgggagggagcggcgcgcgaaccgtccgggggcagcagcggcagcgaggcggcgccgcaggacggtgactgtcccagccccggccgtggcaccaaacgaaagaagaagcagcgccggaatcgaaccacattcaacagcagccagctgcaggcgctggagcgtgtatttgagcgcacacactaccctgacgcctttgtgcgtgaagagctagctcgccgtgtcaacctcagtgaggcacgtgtccaagtctggttccagaaccgccgtgccaagtttcgccggaatgaacgtgccatgctggctacccgctctgcctcgttgctcaagtcttatggccaggaggcggccattgaacagcctgtggccccccgacctaccacgatgagcccagattatctatcctggccagcatcctccccctacagctccgtgcctccctatagccccggaggttcaagtcctgcaactcctggagtcaacatggccaacagcatcgccagccttcgcctcaaggccaaagagttcagcctacaccacagccaggtgcccacagtgaactgactgtgcattgggtccagcttcctccctggcccaatggcagactgcagcaaaggcagtagccttgtctgtctctgtcctcagacaaactgggcagcctctcccgtgccttttctccatcacagcttcctgagttccagaggcctgttgggtgctggaagcagttgaacaagtcactgctatggtggctgagattgtggcctaaggcccctggagtggcctggccagaaggcggagctggagtccgccaaggaactcacttacttatgtattaaaaccaaaaagcttttgtctttaaggaataaaaccatttttcgtaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]