LOCUS       NM_001368836            2028 bp    mRNA    linear   ROD 29-OCT-2024
DEFINITION  Mus musculus piwi-like RNA-mediated gene silencing 4 (Piwil4),
            transcript variant 3, mRNA.
ACCESSION   NM_001368836
VERSION     NM_001368836.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 2028)
  AUTHORS   Dias Mirandela,M., Zoch,A., Leismann,J., Webb,S., Berrens,R.V.,
            Valsakumar,D., Kabayama,Y., Auchynnikava,T., Schito,M.,
            Chowdhury,T., MacLeod,D., Xiang,X., Zou,J., Rappsilber,J.,
            Allshire,R.C., Voigt,P., Cook,A.G., Barau,J. and O'Carroll,D.
  TITLE     Two-factor authentication underpins the precision of the piRNA
            pathway
  JOURNAL   Nature 634 (8035), 979-985 (2024)
   PUBMED   39294378
  REMARK    GeneRIF: Two-factor authentication underpins the precision of the
            piRNA pathway.
REFERENCE   2  (bases 1 to 2028)
  AUTHORS   Wen,Y., Zhou,S., Gui,Y., Li,Z., Yin,L., Xu,W., Feng,S., Ma,X.,
            Gan,S., Xiong,M., Dong,J., Cheng,K., Wang,X. and Yuan,S.
  TITLE     hnRNPU is required for spermatogonial stem cell pool establishment
            in mice
  JOURNAL   Cell Rep 43 (4), 114113 (2024)
   PUBMED   38625792
REFERENCE   3  (bases 1 to 2028)
  AUTHORS   Zoch,A., Konieczny,G., Auchynnikava,T., Stallmeyer,B., Rotte,N.,
            Heep,M., Berrens,R.V., Schito,M., Kabayama,Y., Schopp,T.,
            Kliesch,S., Houston,B., Nagirnaja,L., O'Bryan,M.K., Aston,K.I.,
            Conrad,D.F., Rappsilber,J., Allshire,R.C., Cook,A.G., Tuttelmann,F.
            and O'Carroll,D.
  TITLE     C19ORF84 connects piRNA and DNA methylation machineries to defend
            the mammalian germ line
  JOURNAL   Mol Cell 84 (6), 1021-1035 (2024)
   PUBMED   38359823
REFERENCE   4  (bases 1 to 2028)
  AUTHORS   Ren,J.S., Bai,W., Ding,J.J., Zhao,Y., Wang,S.Y., Chen,X. and
            Jiang,Q.
  TITLE     The role of PIWIL4 and piRNAs in the development of choroidal
            neovascularization
  JOURNAL   Genomics 115 (3), 110615 (2023)
   PUBMED   36934857
  REMARK    GeneRIF: The role of PIWIL4 and piRNAs in the development of
            choroidal neovascularization.
REFERENCE   5  (bases 1 to 2028)
  AUTHORS   Ramakrishna,N.B., Battistoni,G., Surani,M.A., Hannon,G.J. and
            Miska,E.A.
  TITLE     Mouse primordial germ-cell-like cells lack piRNAs
  JOURNAL   Dev Cell 57 (23), 2661-2668 (2022)
   PUBMED   36473462
REFERENCE   6  (bases 1 to 2028)
  AUTHORS   Aravin,A.A., Sachidanandam,R., Bourc'his,D., Schaefer,C., Pezic,D.,
            Toth,K.F., Bestor,T. and Hannon,G.J.
  TITLE     A piRNA pathway primed by individual transposons is linked to de
            novo DNA methylation in mice
  JOURNAL   Mol Cell 31 (6), 785-799 (2008)
   PUBMED   18922463
REFERENCE   7  (bases 1 to 2028)
  AUTHORS   Kuramochi-Miyagawa,S., Watanabe,T., Gotoh,K., Totoki,Y., Toyoda,A.,
            Ikawa,M., Asada,N., Kojima,K., Yamaguchi,Y., Ijiri,T.W., Hata,K.,
            Li,E., Matsuda,Y., Kimura,T., Okabe,M., Sakaki,Y., Sasaki,H. and
            Nakano,T.
  TITLE     DNA methylation of retrotransposon genes is regulated by Piwi
            family members MILI and MIWI2 in murine fetal testes
  JOURNAL   Genes Dev 22 (7), 908-917 (2008)
   PUBMED   18381894
  REMARK    GeneRIF: Data strongly suggest that MILI and MIWI2 play essential
            roles in establishing de novo DNA methylation of retrotransposons
            in fetal male germ cells.
REFERENCE   8  (bases 1 to 2028)
  AUTHORS   Carmell,M.A., Girard,A., van de Kant,H.J., Bourc'his,D.,
            Bestor,T.H., de Rooij,D.G. and Hannon,G.J.
  TITLE     MIWI2 is essential for spermatogenesis and repression of
            transposons in the mouse male germline
  JOURNAL   Dev Cell 12 (4), 503-514 (2007)
   PUBMED   17395546
REFERENCE   9  (bases 1 to 2028)
  AUTHORS   Costa,Y., Speed,R.M., Gautier,P., Semple,C.A., Maratou,K.,
            Turner,J.M. and Cooke,H.J.
  TITLE     Mouse MAELSTROM: the link between meiotic silencing of unsynapsed
            chromatin and microRNA pathway?
  JOURNAL   Hum Mol Genet 15 (15), 2324-2334 (2006)
   PUBMED   16787967
REFERENCE   10 (bases 1 to 2028)
  AUTHORS   Carmell,M.A., Xuan,Z., Zhang,M.Q. and Hannon,G.J.
  TITLE     The Argonaute family: tentacles that reach into RNAi, developmental
            control, stem cell maintenance, and tumorigenesis
  JOURNAL   Genes Dev 16 (21), 2733-2742 (2002)
   PUBMED   12414724
  REMARK    Review article
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            CT030247.6.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK143022.1, SRR12282455.28184874.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849375, SAMN00849380
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-152               CT030247.6         100121-100272
            153-264             CT030247.6         102669-102780
            265-449             CT030247.6         103481-103665
            450-522             CT030247.6         106166-106238
            523-723             CT030247.6         108396-108596
            724-827             CT030247.6         109543-109646
            828-898             CT030247.6         112229-112299
            899-1052            CT030247.6         113449-113602
            1053-1181           CT030247.6         114790-114918
            1182-1329           CT030247.6         115336-115483
            1330-2028           CT030247.6         116034-116732
FEATURES             Location/Qualifiers
     source          1..2028
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="9"
                     /map="9 4.25 cM"
     gene            1..2028
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /note="piwi-like RNA-mediated gene silencing 4"
                     /db_xref="GeneID:330890"
                     /db_xref="MGI:MGI:3041167"
     exon            1..152
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /inference="alignment:Splign:2.1.0"
     CDS             70..1446
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /note="isoform 3 is encoded by transcript variant 3;
                     piwi-like protein 4; piwi-like 4; piwi-like homolog 4"
                     /codon_start=1
                     /product="piwi-like protein 4 isoform 3"
                     /protein_id="NP_001355765.1"
                     /db_xref="GeneID:330890"
                     /db_xref="MGI:MGI:3041167"
                     /translation="

MKAVAEETRLSPVGRQQQLARLVDDIQRNPVARFELETWGLHFGSQLSLTGRVVPSEKILLQDHTCQPAFAADWSKDMRSCKVLSSQPLNRWLIVCCNRAEHLIEAFLSCLRRVGGSMGFNVGYPKIIKVDETPAAFLRAIQVHGDPDVQLVMCILPSNQKNYYDSIKKYLSSDCPVPSQCVLTRTLNKQGTMLSVATKIAMQMTCKLGGELWSVEIPLKSLMVVGIDICRDALNKNVVVVGFVASINSRITRWFSRCVLQRTAADIADCLKVCMTGALNRWYRHNHDLPARIVVYRDGVGNGQLKAVLEYEVPQLLKSVTECGSDARSCRLSVVVVRKRCLLRLFASTDHTVQNPPLGTVVDSEATRPEWYDFYLISQTANRGTVSPTHYNVIYDDNALKPDHMQRLTFKLCHLYYNWQGLISVPAPCQYAHKLTFLVAQSVHKEPSLELANNLFYL"

     misc_feature    70..1392
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /note="PIWI domain, Piwi-like subfamily found in
                     eukaryotes. This domain is found in Piwi and closely
                     related proteins, where it is believed to perform a
                     crucial role in germline cells, via RNA silencing. RNA
                     silencing refers to a group of related...; Region:
                     Piwi_piwi-like_Euk; cd04658"
                     /db_xref="CDD:240016"
     misc_feature    order(559..561,571..573,607..618,625..627,655..657,
                     664..666,676..678,688..690)
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240016"
     misc_feature    order(751..753,757..759,961..963,1366..1368)
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /note="active site"
                     /db_xref="CDD:240016"
     exon            153..264
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /inference="alignment:Splign:2.1.0"
     exon            265..449
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /inference="alignment:Splign:2.1.0"
     exon            450..522
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /inference="alignment:Splign:2.1.0"
     exon            523..723
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /inference="alignment:Splign:2.1.0"
     exon            724..827
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /inference="alignment:Splign:2.1.0"
     exon            828..898
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /inference="alignment:Splign:2.1.0"
     exon            899..1052
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /inference="alignment:Splign:2.1.0"
     exon            1053..1181
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /inference="alignment:Splign:2.1.0"
     exon            1182..1329
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /inference="alignment:Splign:2.1.0"
     exon            1330..2028
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /inference="alignment:Splign:2.1.0"
     regulatory      2005..2010
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /note="hexamer: AATAAA"
     polyA_site      2026
                     /gene="Piwil4"
                     /gene_synonym="9230101H05Rik; mAgo5; Miwi2"
                     /note="major polyA site"
ORIGIN      

actctctgcactcacctttgcttgcctctcccaggcctgagcagccaagcaacctcagatttccgcctgatgaaggcagtagctgaagagactcggctcagtcctgtgggaaggcagcagcagctggcccgactcgtggatgacatccagaggaacccagtggctcggtttgagcttgagacctggggattgcattttggaagccagctatccctgaccggccgggttgttccctctgaaaaaatcctgctgcaggaccacacatgtcaacctgcatttgctgctgactggtccaaagatatgcgatcttgcaaagttttgagttctcagcctttgaatagatggttgatcgtgtgctgtaacagggctgagcacttgattgaagcctttctgagctgtctgaggagagttggaggttccatgggatttaacgtgggctaccccaaaatcataaaagtggacgagaccccagcagcgttccttcgagccatccaggtgcacggcgaccccgatgttcagttggtgatgtgcattctgccttctaatcagaagaactattacgactccattaaaaagtatttgagctctgactgcccagtgccaagccagtgtgtgctgacccggaccttgaataagcagggaacgatgctgagtgtggccaccaagatcgccatgcagatgacctgcaaacttggcggagagctgtggtctgtggagatcccattgaagtccctgatggtcgtgggtattgatatctgcagagatgccctcaacaagaatgtggtggtcgtcgggtttgtagccagcattaattccaggatcaccaggtggttttcccgctgtgtccttcagagaacagcggctgatattgcagattgcctcaaagtctgcatgactggtgctctcaaccggtggtacagacacaaccatgacttgccggcacggatagtcgtgtaccgggacggtgtaggcaatggccagctaaaggcagttttggaatatgaagtcccacagctactgaaaagtgtaacagagtgcggctcggatgccaggagctgcagactgtccgtggttgtggtcaggaagagatgtctactgcgcctctttgcttcgactgaccacactgtgcagaaccccccactcggcactgttgtggactcagaagcaacacgtccggagtggtatgacttctacctgatcagccagactgctaaccgggggactgttagtcccacccactacaacgttatctatgatgacaatgccttgaagcctgaccacatgcagcgactgaccttcaaactgtgccatctctactacaactggcagggcttaatcagtgtccccgcaccatgccaatatgcacacaagctgaccttcctggtggcacaaagtgtccacaaggaaccaagtctggaattagccaataatcttttctacctctgacaagtgagccagaggacggcttgagactccgaaagcagtggctctgcgttgttcagatctgcctaccgctcaggctcctgcggcttacggggcttgggcctaactttaagtattgggaagggggggttgttttgttttgttttgttttgttttttaaaaaaaaaactcatttgaaaaagttcagaacaaacctatggggatttttgtttcacttgtgtctaaaaccaacaaagacaaacaaacagaacccacagagtgatgggttttcttgtggctttgtcatgtgtcattttactttggcctggttcagccttgtatttctcttctcttctcttctcttctcttctcttctcttcttttctttctttctttttcttttttttaagtcagtgcttgaggtaaattctcatgtggtacttgggatatatcatcacagcttctaaaacaatatttgtgtggtattttgatggtacatagtggggtttaacttcaggaaattatcagagtttttctaaacattgtagagcattttgtagagtgggttaagtaaatattgaaaataaagaaaatctaagcatcaca

//