GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-07 04:15:23, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001368357            2104 bp    mRNA    linear   ROD 08-AUG-2023
DEFINITION  Mus musculus double C2, alpha (Doc2a), transcript variant 4, mRNA.
ACCESSION   NM_001368357 XM_017321967
VERSION     NM_001368357.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 2104)
  AUTHORS   Wang QW, Qin J, Chen YF, Tu Y, Xing YY, Wang Y, Yang LY, Lu SY,
            Geng L, Shi W, Yang Y and Yao J.
  TITLE     16p11.2 CNV gene Doc2alpha functions in neurodevelopment and social
            behaviors through interaction with Secretagogin
  JOURNAL   Cell Rep 42 (7), 112691 (2023)
   PUBMED   37354460
  REMARK    GeneRIF: 16p11.2 CNV gene Doc2alpha functions in neurodevelopment
            and social behaviors through interaction with Secretagogin.
REFERENCE   2  (bases 1 to 2104)
  AUTHORS   Bourgeois-Jaarsma Q, Miaja Hernandez P and Groffen AJ.
  TITLE     Ca2+ sensor proteins in spontaneous release and synaptic
            plasticity: Limited contribution of Doc2c, rabphilin-3a and
            synaptotagmin 7 in hippocampal glutamatergic neurons
  JOURNAL   Mol Cell Neurosci 112, 103613 (2021)
   PUBMED   33753311
  REMARK    GeneRIF: Ca(2+) sensor proteins in spontaneous release and synaptic
            plasticity: Limited contribution of Doc2c, rabphilin-3a and
            synaptotagmin 7 in hippocampal glutamatergic neurons.
REFERENCE   3  (bases 1 to 2104)
  AUTHORS   Diez-Arazola R, Meijer M, Bourgeois-Jaarsma Q, Cornelisse LN,
            Verhage M and Groffen AJ.
  TITLE     Doc2 Proteins Are Not Required for the Increased Spontaneous
            Release Rate in Synaptotagmin-1-Deficient Neurons
  JOURNAL   J Neurosci 40 (13), 2606-2617 (2020)
   PUBMED   32098902
  REMARK    GeneRIF: Doc2 Proteins Are Not Required for the Increased
            Spontaneous Release Rate in Synaptotagmin-1-Deficient Neurons.
REFERENCE   4  (bases 1 to 2104)
  AUTHORS   Bourgeois-Jaarsma Q, Verhage M and Groffen AJ.
  TITLE     Doc2b Ca2+ binding site mutants enhance synaptic release at rest at
            the expense of sustained synaptic strength
  JOURNAL   Sci Rep 9 (1), 14408 (2019)
   PUBMED   31594980
  REMARK    GeneRIF: Doc2b Ca(2+) binding site mutants enhance synaptic release
            at rest at the expense of sustained synaptic strength.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2104)
  AUTHORS   Courtney NA, Briguglio JS, Bradberry MM, Greer C and Chapman ER.
  TITLE     Excitatory and Inhibitory Neurons Utilize Different Ca2+ Sensors
            and Sources to Regulate Spontaneous Release
  JOURNAL   Neuron 98 (5), 977-991 (2018)
   PUBMED   29754754
  REMARK    GeneRIF: Doc2alpha promoted glutamatergic spontaneous
            neurotransmitter release, while Doc2beta and syt1 both regulated
            GABAergic spontaneous neurotransmitter release.
REFERENCE   6  (bases 1 to 2104)
  AUTHORS   Groffen AJ, Friedrich R, Brian EC, Ashery U and Verhage M.
  TITLE     DOC2A and DOC2B are sensors for neuronal activity with unique
            calcium-dependent and kinetic properties
  JOURNAL   J Neurochem 97 (3), 818-833 (2006)
   PUBMED   16515538
REFERENCE   7  (bases 1 to 2104)
  AUTHORS   Toonen RF, de Vries KJ, Zalm R, Sudhof TC and Verhage M.
  TITLE     Munc18-1 stabilizes syntaxin 1, but is not essential for syntaxin 1
            targeting and SNARE complex formation
  JOURNAL   J Neurochem 93 (6), 1393-1400 (2005)
   PUBMED   15935055
REFERENCE   8  (bases 1 to 2104)
  AUTHORS   Bouwman J, Maia AS, Camoletto PG, Posthuma G, Roubos EW, Oorschot
            VM, Klumperman J and Verhage M.
  TITLE     Quantification of synapse formation and maintenance in vivo in the
            absence of synaptic release
  JOURNAL   Neuroscience 126 (1), 115-126 (2004)
   PUBMED   15145078
REFERENCE   9  (bases 1 to 2104)
  AUTHORS   Sakaguchi G, Manabe T, Kobayashi K, Orita S, Sasaki T, Naito A,
            Maeda M, Igarashi H, Katsuura G, Nishioka H, Mizoguchi A, Itohara
            S, Takahashi T and Takai Y.
  TITLE     Doc2alpha is an activity-dependent modulator of excitatory synaptic
            transmission
  JOURNAL   Eur J Neurosci 11 (12), 4262-4268 (1999)
   PUBMED   10594652
REFERENCE   10 (bases 1 to 2104)
  AUTHORS   Naito A, Orita S, Wanaka A, Sasaki T, Sakaguchi G, Maeda M,
            Igarashi H, Tohyama M and Takai Y.
  TITLE     Molecular cloning of mouse Doc2alpha and distribution of its mRNA
            in adult mouse brain
  JOURNAL   Brain Res Mol Brain Res 44 (2), 198-204 (1997)
   PUBMED   9073161
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC124505.4.
            
            On Feb 8, 2019 this sequence version replaced XM_017321967.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR7345562.4256118.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849385, SAMN01164131
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-46                AC124505.4         188485-188530
            47-494              AC124505.4         189183-189630
            495-574             AC124505.4         189988-190067
            575-649             AC124505.4         190250-190324
            650-759             AC124505.4         190430-190539
            760-886             AC124505.4         191702-191828
            887-946             AC124505.4         191908-191967
            947-1110            AC124505.4         192051-192214
            1111-1192           AC124505.4         192305-192386
            1193-1289           AC124505.4         192477-192573
            1290-2104           AC124505.4         192659-193473
FEATURES             Location/Qualifiers
     source          1..2104
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="7"
                     /map="7 69.25 cM"
     gene            1..2104
                     /gene="Doc2a"
                     /note="double C2, alpha"
                     /db_xref="GeneID:13446"
                     /db_xref="MGI:MGI:109446"
     exon            1..46
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            47..494
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    152..154
                     /gene="Doc2a"
                     /note="upstream in-frame stop codon"
     CDS             218..1435
                     /gene="Doc2a"
                     /note="doc2-alpha"
                     /codon_start=1
                     /product="double C2-like domain-containing protein alpha"
                     /protein_id="NP_001355286.1"
                     /db_xref="CCDS:CCDS21847.1"
                     /db_xref="GeneID:13446"
                     /db_xref="MGI:MGI:109446"
                     /translation="
MRGRRGDRMTINIQEHMAINVCPGPIRPIRQISDYFPRRGPGPEGGGGGGGTGCGEAPAHLAPLALAPPAALLGATTPDDGAEVDSYDSDDTTALGTLEFDLLYDQASCMLHCRILRAKGLKPMDFNGLADPYVKLHLLPGACKANKLKTKTQRNTLNPVWNEELTYSGITDDDITHKVLRISVCDEDKLSHNEFIGEIRVPLRRLKPSQKKHFNICLERQVPLPSPSSMSAALRGISCYLKELEQAEQGPGLLEERGRILLSLSYSSRRHGLLVGIVRCAHLAAMDVNGYSDPYVKTYLRPDVDKKSKHKTCVKKKTLNPEFNEEFFYEIELSTLATKTLEVTVWDYDIGKSNDFIGGVSLGPGARGEAQKHWNDCLHQPDTALERWHTLTSELPPAAGAYPLA"
     misc_feature    218..499
                     /gene="Doc2a"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1);
                     Region: Interaction with UNC13D and DYNLT1.
                     /evidence=ECO:0000250"
     misc_feature    317..379
                     /gene="Doc2a"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    500..871
                     /gene="Doc2a"
                     /note="C2 domain first repeat present in Rabphilin and
                     Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035"
                     /db_xref="CDD:176000"
     misc_feature    order(590..592,608..610,773..775,779..781,797..799)
                     /gene="Doc2a"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:176000"
     misc_feature    875..1432
                     /gene="Doc2a"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1);
                     Region: Interaction with UNC13D. /evidence=ECO:0000250"
     misc_feature    992..1390
                     /gene="Doc2a"
                     /note="C2 domain second repeat present in Rabphilin and
                     Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384"
                     /db_xref="CDD:176030"
     misc_feature    order(1076..1078,1094..1096,1256..1258,1262..1264,
                     1280..1282)
                     /gene="Doc2a"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:176030"
     exon            495..574
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            575..649
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            650..759
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            760..886
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            887..946
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            947..1110
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1111..1192
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1193..1289
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1290..2104
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ggggaacaccgggcgcctctcgcggaggtgcacgccaagttctcgggactgatctggcaacccacccagccctttgtgaagccaggcctcctgcctgcccaccagccagcgcagatcatcttttccctcgacacccaggaagggagggcagtgaggttcctacagaccccagccggccactccagctctacacccgtctcccagtcagaggtgctgcatgaggggccgcaggggcgatcgcatgaccatcaacatccaggagcacatggccatcaacgtgtgccctggacccatcaggcccatccgccagatctccgactacttccctcgcagggggccaggaccagagggtggcggcggcggcggtggcacgggctgcggggaagccccagctcatctggcccctctggctctggccccccctgcggctctccttggggccactacacccgacgatggagctgaggtagacagctacgactcggatgataccaccgccctgggcacactggaatttgaccttctctatgatcaggcttcctgcatgctgcactgtagaatcctcagggccaagggcctcaagcccatggatttcaatggcctggctgacccctatgtaaagcttcacctcctgccaggagcctgcaaggccaataagctaaaaaccaagacacagaggaacacactgaaccctgtgtggaatgaggagctgacgtacagcgggatcacggatgatgacatcacccacaaggtgctcaggatctctgtctgtgatgaggacaagctgagccacaatgaattcattggggagatccgagtgcccctccgccgcctcaagccttcacagaagaagcattttaacatctgccttgagcgccaggtcccgcttccttcaccctcttcaatgtctgcggcgctgaggggcatatcctgttacctgaaggagctggagcaggcagagcagggacctgggctgctggaagagcgcgggcgcatcctgctgagcctcagctacagctctcggcggcatgggctgctggtgggcattgttcgctgtgcgcacctggctgcaatggatgttaacggctactctgacccttatgtgaagacgtacttgagaccagatgtggataagaaatccaagcacaaaacatgtgtaaagaagaagacactaaatccggaatttaatgaggaattcttctatgagattgaactctccactctggccactaagaccctggaggtcacagtctgggactacgacattggcaaatccaatgacttcataggtggtgtgtctctggggccaggagcccggggagaggcccagaaacactggaatgactgtctacatcagccggacacagccctggagcgctggcatactctgaccagcgagctgccccctgcagcaggggcttaccctttggcttgagtgaacagcagctgtccatcacaggccctctggggccgggtccagtacccaaccttcgcacgagtgtgttgcacgtttacatggggtgggatgcccctgccccacactacctgtcttatttttgtgagtctctgtgacgggcctgtcttcttgtgagggactgtggagagctatattcacatatgcaaacttcctcctgcctgccttgctgttacctgcaaatatgcaaccacccgtgcacagggccacgtgggagtctcctgccagtgccccaccccatcctgcagctcctttcttggcctttccaggctgcctggtcccctgccccacagggagggggtcggattagggaagattagaggaggacgtttccaaatagaggaaaggacaaggaaagaaagagccaactctttaatacagagccttcactaaatcccagccctgcgtagctgctcttctaaaggggcggccaccgtaggtctctacctcccgaagatgtagcagacccttttggccactcgtttaaataactgttccctggatggggctgggatgtaagggcaggaccctgccaccttcctcggggacattgtgcatgtttacgccttttctgattgtgtcagtggccgaagcatggcaactgggcatcaataaacatctcttgaggaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]