2024-05-07 02:59:25, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001033335 2213 bp mRNA linear ROD 06-AUG-2023 DEFINITION Mus musculus serine (or cysteine) peptidase inhibitor, clade A, member 3F (Serpina3f), transcript variant 2, mRNA. ACCESSION NM_001033335 XM_893682 XM_910175 VERSION NM_001033335.3 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 2213) AUTHORS Kidoya H, Naito H, Muramatsu F, Yamakawa D, Jia W, Ikawa M, Sonobe T, Tsuchimochi H, Shirai M, Adams RH, Fukamizu A and Takakura N. TITLE APJ Regulates Parallel Alignment of Arteries and Veins in the Skin JOURNAL Dev Cell 33 (3), 247-259 (2015) PUBMED 25920569 REFERENCE 2 (bases 1 to 2213) AUTHORS Heit C, Jackson BC, McAndrews M, Wright MW, Thompson DC, Silverman GA, Nebert DW and Vasiliou V. TITLE Update of the human and mouse SERPIN gene superfamily JOURNAL Hum Genomics 7 (1), 22 (2013) PUBMED 24172014 REMARK Review article Publication Status: Online-Only REFERENCE 3 (bases 1 to 2213) AUTHORS Archambaud C, Nahori MA, Soubigou G, Becavin C, Laval L, Lechat P, Smokvina T, Langella P, Lecuit M and Cossart P. TITLE Impact of lactobacilli on orally acquired listeriosis JOURNAL Proc Natl Acad Sci U S A 109 (41), 16684-16689 (2012) PUBMED 23012479 REFERENCE 4 (bases 1 to 2213) AUTHORS Ghesquiere B, Van Damme J, Martens L, Vandekerckhove J and Gevaert K. TITLE Proteome-wide characterization of N-glycosylation events by diagonal chromatography JOURNAL J Proteome Res 5 (9), 2438-2447 (2006) PUBMED 16944957 REFERENCE 5 (bases 1 to 2213) AUTHORS Winkler IG, Hendy J, Coughlin P, Horvath A and Levesque JP. TITLE Serine protease inhibitors serpina1 and serpina3 are down-regulated in bone marrow during hematopoietic progenitor mobilization JOURNAL J Exp Med 201 (7), 1077-1088 (2005) PUBMED 15795238 REFERENCE 6 (bases 1 to 2213) AUTHORS Horvath AJ, Forsyth SL and Coughlin PB. TITLE Expression patterns of murine antichymotrypsin-like genes reflect evolutionary divergence at the Serpina3 locus JOURNAL J Mol Evol 59 (4), 488-497 (2004) PUBMED 15638460 REFERENCE 7 (bases 1 to 2213) AUTHORS Forsyth S, Horvath A and Coughlin P. TITLE A review and comparison of the murine alpha1-antitrypsin and alpha1-antichymotrypsin multigene clusters with the human clade A serpins JOURNAL Genomics 81 (3), 336-345 (2003) PUBMED 12659817 REMARK Review article REFERENCE 8 (bases 1 to 2213) AUTHORS Inglis JD and Hill RE. TITLE The murine Spi-2 proteinase inhibitor locus: a multigene family with a hypervariable reactive site domain JOURNAL EMBO J 10 (2), 255-261 (1991) PUBMED 1991447 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AK138954.1, BC139132.1 and AC142112.3. On Nov 28, 2009 this sequence version replaced NM_001033335.2. Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All three variants encode the same protein. ##Evidence-Data-START## Transcript exon combination :: AK138954.1 [ECO:0000332] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1086 AK138954.1 2-1087 1087-1996 BC139132.1 976-1885 1997-2207 AK138954.1 1998-2208 2208-2213 AC142112.3 76336-76341 c FEATURES Location/Qualifiers source 1..2213 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="12" /map="12 53.65 cM" gene 1..2213 /gene="Serpina3f" /gene_synonym="2A1" /note="serine (or cysteine) peptidase inhibitor, clade A, member 3F" /db_xref="GeneID:238393" /db_xref="MGI:MGI:2182838" exon 1..36 /gene="Serpina3f" /gene_synonym="2A1" /inference="alignment:Splign:2.1.0" exon 37..248 /gene="Serpina3f" /gene_synonym="2A1" /inference="alignment:Splign:2.1.0" misc_feature 243..245 /gene="Serpina3f" /gene_synonym="2A1" /note="upstream in-frame stop codon" exon 249..867 /gene="Serpina3f" /gene_synonym="2A1" /inference="alignment:Splign:2.1.0" CDS 261..1598 /gene="Serpina3f" /gene_synonym="2A1" /note="antitrypsin; alpha-1 antiproteinasin; serpin A3F" /codon_start=1 /product="serine protease inhibitor A3F" /protein_id="NP_001028507.2" /db_xref="CCDS:CCDS26149.1" /db_xref="GeneID:238393" /db_xref="MGI:MGI:2182838" /translation="
MAGVSPAVFGCPDVTLGRNTAVREVQENITSVDSLTLASSNTDFAFSLYKELVLKNPDENVVFSPFSICTALALLSLGAKSNTLKEILEGLKFNLTETPEPDIHQGFRYLLDLLSQPGNQVQISTGSALFIEKHLQILAEFKEKARALYQAEAFTADFQQPLEATKLINDYVSNHTQGKIKELISDLDKRTLMVLVNYIYFKGKWEMPFDPDDTCKSEFYLDENRSVKVPMMKINNLTTPYFRDEELSCTVVELKYTGNASAMFILPDQGKMQQVEASLQPETLRNWKDSLKPRLINELCLPKFSISTDYSLEHILPELGIRELFSTQADLSAITGTKDLRTSQVVHKAVLDVAETGTEAAAGTGYQNLQCCQGVIYSMKIYFDRPFLMIISDTNTHIALFMAKVSNPESDENFLNVEYAFPQVLEIMPEYRSVCTCCLPCLTRQ"
misc_feature 339..1487 /gene="Serpina3f" /gene_synonym="2A1" /note="serpin family A member 3, alpha 1-antichymotrypsin; Region: serpinA3_A1AC; cd19551" /db_xref="CDD:381019" misc_feature 342..344 /gene="Serpina3f" /gene_synonym="2A1" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site" misc_feature 540..542 /gene="Serpina3f" /gene_synonym="2A1" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site" misc_feature 780..782 /gene="Serpina3f" /gene_synonym="2A1" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000269|PubMed:16944957; propagated from UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site" misc_feature 1035..1037 /gene="Serpina3f" /gene_synonym="2A1" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site" misc_feature order(1323..1361,1365..1376,1380..1382,1392..1418) /gene="Serpina3f" /gene_synonym="2A1" /note="reactive center loop (RCL); other site" /db_xref="CDD:381019" misc_feature 1329..1406 /gene="Serpina3f" /gene_synonym="2A1" /note="propagated from UniProtKB/Swiss-Prot (Q80X76.3); Region: RCL" misc_feature 1371..1376 /gene="Serpina3f" /gene_synonym="2A1" /note="Reactive bond. /evidence=ECO:0000250; propagated from UniProtKB/Swiss-Prot (Q80X76.3); other site" exon 868..1141 /gene="Serpina3f" /gene_synonym="2A1" /inference="alignment:Splign:2.1.0" exon 1142..1292 /gene="Serpina3f" /gene_synonym="2A1" /inference="alignment:Splign:2.1.0" exon 1293..2213 /gene="Serpina3f" /gene_synonym="2A1" /inference="alignment:Splign:2.1.0" ORIGIN
actttctctctggtgaacagaaggagtcttcactggaaggtttacagcagtcacctgagtccttccagaagacccctcttggaagagaagaattagcactaaaatacaaacagcaccaggaccatccacaacagaactgagctgtcaaagccattggcaagatcttaaaaactaaagaagagaagggaagaacaagctctaggaaaatgagagtggaggaaaagacagcagcttccaaacaatgagcagagaagagagtaatggctggtgtctcccctgctgtctttggctgcccagatgtcaccctgggaaggaacactgcagtccgtgaagtccaagaaaatatcacatcagtggacagtttaacactggcctccagcaacactgactttgccttcagcctctacaaggagctggttttgaagaatccagatgaaaatgttgtcttctccccattcagcatctgcactgccttggccctgctgtccctgggagcaaagagcaacaccctgaaggaaatcctagaaggtctcaagttcaacctcacagagacccctgaaccagacatccaccagggctttaggtacttgctagaccttctcagtcagccagggaaccaggtacagatcagcacaggcagtgccctgtttattgaaaagcacctgcagatcctggcagagttcaaggagaaagcaagggctctgtaccaggctgaggccttcacagcagatttccagcagcctctcgaggccacaaagctcatcaatgactatgtgagcaatcacacccaggggaagatcaaggaactcatttcagacctggataaaaggacattgatggtgctggtgaattacatctactttaaaggcaaatgggagatgccctttgatccggatgatacatgtaagtctgagttctacttggatgagaataggtctgtgaaggtgcccatgatgaaaattaataacctgacgacaccctacttccgggatgaggagctgtcctgcactgtggtggagctgaagtacacaggaaatgccagtgccatgttcatcctcccggaccagggcaagatgcagcaggtggaagccagcttgcaaccagagaccctgaggaattggaaggactctctgaagcccaggttgataaatgagctctgcctgcccaagttctccatctccaccgactacagcctggagcacatccttcctgagctgggcatcagggagctcttctccacccaggctgacctgtctgcaatcacaggaaccaaggatctgagaacttctcaggtggtccacaaggctgtgctggatgtggctgagacaggcacagaagcagctgctggcacaggatatcaaaatctccaatgttgtcaaggtgtaatctactctatgaaaatatatttcgacaggccattcctgatgattatctctgacacaaacactcatattgccctctttatggcaaaagtttcaaatccagagagtgatgagaacttcctaaatgtggagtatgcttttccccaagtgctggaaattatgcctgaatataggtctgtctgcacatgttgccttccatgtctgactagacagtgacactgaccaattctgtcacgtcctcatgcagagaaacaagcctatgactggttattgtcagactccctgtcataatggtagcactaaatcaagttcctgacctgaaatttttgttattccccgtccctgctgtctccactgtatctgcttcaactcaaaagactgggaccgtcagtgaggctctctcctaacttaggctctgcttatgtctgccttcagcttttcagtaatgatgggactatacaagtttacaggccaacccataaggtttaagaagggaacctgcaactgtggtcctatctgcagcatctgaaatgtttggtgcccagttctaccttactcttgccttcctctgggcagagctattctcagtccctgcatagtctcctggccccacccagatctgatacaggtggagccctcacccctgcagctgcatggggctgtgggtcagggtagttcttctacccctagcactcctaatcaggacagagaagtcgcctaaccctaagtgtctagttgaccaaccacacaagacagatggacacctccaccttcatcacacaaattgaaagggcaggagctaaggatcaataaacatgtaactgcattgaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]