2025-02-23 08:30:52, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XR_011351402 266 bp RNA linear VRT 18-NOV-2024 DEFINITION PREDICTED: Narcine bancroftii uncharacterized lncRNA (LOC138753746), ncRNA. ACCESSION XR_011351402 VERSION XR_011351402.1 DBLINK BioProject: PRJNA1181001 KEYWORDS RefSeq. SOURCE Narcine bancroftii (Caribbean electric ray) ORGANISM Narcine bancroftii Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Chondrichthyes; Elasmobranchii; Batoidea; Torpediniformes; Narcinidae; Narcine. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_091469) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_036971445.1-RS_2024_11 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 11/13/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..266 /organism="Narcine bancroftii" /mol_type="transcribed RNA" /isolate="sNarBan1" /db_xref="taxon:1343680" /chromosome="1" /sex="male" /tissue_type="blood" /dev_stage="adult" /geo_loc_name="USA: Apalachee Bay near Panacea, Florida" /lat_lon="30.037222 N 84.170833 W" /collection_date="2020-10-03" /collected_by="Gavin Naylor" gene 1..266 /gene="LOC138753746" /note="uncharacterized LOC138753746; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:138753746" ncRNA 1..266 /ncRNA_class="lncRNA" /gene="LOC138753746" /product="uncharacterized lncRNA" /db_xref="GeneID:138753746" ORIGIN
gtctcattaagcacttcgtctagacagagttaaaatgatgagcaaaggcaactatgttaatgtattacacaatcaagaagagattgtattcgatgtgatggggatcctttatgatgatggctgccttcttgaagcagtgtctcacactgatgtcttcaatagacagaacgccagcactggtgctgaatgttacttcagtgtggaatttgctgtgcaccattccaaaattacaatttgtgtacatcaaggataatccaatgaggagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]