2024-11-15 17:46:13, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS XR_008998512 484 bp RNA linear MAM 21-JUN-2023 DEFINITION PREDICTED: Manis pentadactyla uncharacterized LOC118908090 (LOC118908090), ncRNA. ACCESSION XR_008998512 VERSION XR_008998512.1 DBLINK BioProject: PRJNA984222 KEYWORDS RefSeq. SOURCE Manis pentadactyla (Chinese pangolin) ORGANISM Manis pentadactyla Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Pholidota; Manidae; Manis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_080025) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_030020395.1-RS_2023_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/15/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..484 /organism="Manis pentadactyla" /mol_type="transcribed RNA" /isolate="mManPen7" /db_xref="taxon:143292" /chromosome="7" /sex="male" /cell_line="skin cell line fibroblast" /tissue_type="cultured skin fibroblast" /dev_stage="adult" /geo_loc_name="Taiwan: Taipei Zoo, China" /lat_lon="24.9986 N 121.5810 E" /collection_date="2007-01-09" /collected_by="Taipei Zoo (original animal)" gene 1..484 /gene="LOC118908090" /note="uncharacterized LOC118908090; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:118908090" ncRNA 1..484 /ncRNA_class="lncRNA" /gene="LOC118908090" /product="uncharacterized LOC118908090" /db_xref="GeneID:118908090" ORIGIN
caactctccatgcctggacaaacacaaaactgcatgtcttggctccctgccctcctggagtggggaagcaccctgctacactggcaggacatcagctggagtctacaggggaatgaacaaagagaatggcctcttatccacgtctgcagaaaaatcactcacgggatttgacatctgctgcacaccatggagaagacaccttattgatgaaaaagaacacagttcctgaggattgctctgggatggggaaaacttgatcatcttctgccccttgtgctcacagaaactgtttgaggtctgtctcctggggaccccaccctccatttttaggactgaatacctgaagtacagttgtcatcctgttgaatcttatgttacctgcattttatgtcttcaacttctctggttttgtttaagcaaacaatctcttcttgagaagggacagaagggaaataaaattctagatacccaatgtgtccaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]