GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-15 17:44:53, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XR_003374214             153 bp    RNA     linear   VRT 11-OCT-2018
DEFINITION  PREDICTED: Pseudonaja textilis uncharacterized LOC113437314
            (LOC113437314), ncRNA.
ACCESSION   XR_003374214
VERSION     XR_003374214.1
DBLINK      BioProject: PRJNA495355
KEYWORDS    RefSeq.
SOURCE      Pseudonaja textilis
  ORGANISM  Pseudonaja textilis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata;
            Toxicofera; Serpentes; Colubroidea; Elapidae; Acanthophiinae;
            Pseudonaja.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_020769326.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Pseudonaja textilis Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..153
                     /organism="Pseudonaja textilis"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:8673"
                     /chromosome="Unknown"
     gene            1..153
                     /gene="LOC113437314"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:113437314"
     ncRNA           1..153
                     /ncRNA_class="lncRNA"
                     /gene="LOC113437314"
                     /product="uncharacterized LOC113437314"
                     /db_xref="GeneID:113437314"
ORIGIN      
acaatcatccaatggaacagcttgccatcagaagctgtgagtacttcatcacttgagactttcaagaagagattggactgtcatttttcagaaatggtgtaggtctcctgcttgggcaggggtttggactagattacctacaaggtcttttcc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]