GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-15 17:46:06, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XR_002271033             315 bp    RNA     linear   PLN 21-MAR-2017
DEFINITION  PREDICTED: Prunus persica uncharacterized LOC109948414
            (LOC109948414), ncRNA.
ACCESSION   XR_002271033
VERSION     XR_002271033.1
DBLINK      BioProject: PRJNA241430
KEYWORDS    RefSeq.
SOURCE      Prunus persica (peach)
  ORGANISM  Prunus persica
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; fabids; Rosales; Rosaceae; Amygdaloideae;
            Amygdaleae; Prunus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_034012.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Prunus persica Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..315
                     /organism="Prunus persica"
                     /mol_type="transcribed RNA"
                     /cultivar="Lovell"
                     /db_xref="taxon:3760"
                     /chromosome="G4"
     gene            1..315
                     /gene="LOC109948414"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 8 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:109948414"
     ncRNA           1..315
                     /ncRNA_class="lncRNA"
                     /gene="LOC109948414"
                     /product="uncharacterized LOC109948414"
                     /db_xref="GeneID:109948414"
ORIGIN      
gcaaagtcgacagtaatgtgcaacaatcaagagttggccgagatgcattttttaatttcatgtacaagaagagattgctaataaatggaggaaattaaaccttaaagagaaggctacatatggttctgccttggaaggttcgagtgggccaaggattaaaatatcaaccatgtaaataatatagggcctccaatttacggatatttcgggggatatattattatcgtcttaggtatcggaaaaaagaagaagacagatataggtattgaaacacataattttggtataaaactttcattaatgttatgtacatta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]