2025-02-23 08:08:12, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_069669877 1375 bp mRNA linear VRT 15-NOV-2024 DEFINITION PREDICTED: Semicossyphus pulcher vimentin-related 2 (vimr2), mRNA. ACCESSION XM_069669877 VERSION XM_069669877.1 DBLINK BioProject: PRJNA1182355 KEYWORDS RefSeq. SOURCE Semicossyphus pulcher ORGANISM Semicossyphus pulcher Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Eupercaria; Labriformes; Labridae; Semicossyphus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_027211693) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_022749685.1-RS_2024_11 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 11/13/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1375 /organism="Semicossyphus pulcher" /mol_type="mRNA" /isolate="SPU_LCO1_2020_fin" /db_xref="taxon:241346" /chromosome="Unknown" /sex="female" /tissue_type="fin" /dev_stage="adult" /lat_lon="34.04409 N 118.9339 W" /collection_date="2020-08-26" /collected_by="Giacomo Bernardi" gene 1..1375 /gene="vimr2" /note="vimentin-related 2; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 Proteins" /db_xref="GeneID:138598165" CDS 203..1375 /gene="vimr2" /codon_start=1 /product="alpha-internexin" /protein_id="XP_069525978.1" /db_xref="GeneID:138598165" /translation="
MAMLRVSSYRKLFEEDNWSKNGGMSVQCAGQSRASVRAKAVDDCDCDKLDFVAAKALNREGLSRFVQDRTVIAALNDRLVKLIQLAHCFEEENESLECQIVELEEKLSSRPASSGVTSTVAVPDYSLDAVVERLRRERDEILCDTEALHKELERLMTECEKAAQQRILQQQGQQDVAEEVDAVTAQCLALREQVAIYEEQLANMEAQQKMAVEGLLYPDEHATGAVAALKFGSPDITPALDVKEYYCQLAECLQFECGAVSSALVPSGDGKQLEVGGAVGSTVKDPSKIKDVSELKMLISELQKELAELEKCNEELENEVEMKKAAYMEEIAELQCTIDEMRHQEADFEAQMKEQCEDYKVLLSEKMARDMEITAYRSLVEEEEERLCNI"
ORIGIN
gttacgctgcgttttcgcgctcactcttcaggtacatatgaaatcgttactgtctgatgttcacgctattattggtcttctccttggcccgtgaaagatcttccacctcagtgctacattcttaatcatgtcaatataaaatccgcgtcttcgacctgctgccaccatttgtctgttgtgcagtttgaacccatccgaagccatggccatgctcagagtgtcgtcttaccgaaagctgtttgaggaggataactggagcaaaaatggagggatgagtgtacagtgtgcagggcagtcccgcgcctctgtcagggctaaagctgttgacgattgtgactgtgacaagttagactttgtagctgccaaggcgctcaacagggagggtctgagccgctttgtccaggaccgcaccgtcatcgctgccctcaacgaccgcctggtcaaacttattcaactggcccattgttttgaggaggagaatgagtctcttgaatgtcagattgtggagctagaggagaagctgagcagccgaccagcctcctccggcgtcacctccacagtcgcagtgcccgactacagtctggatgcagtggtggaaagactgcgtagggagagggatgagattctgtgtgacacagaggcgctgcacaaagagcttgaacgtctgatgacggagtgcgagaaggctgcacagcagaggatcctccaacagcagggacaacaggatgttgctgaggaagtggacgcggtgacagcacagtgtttggcgctgagggagcaagtggctatctatgaggagcagctggctaacatggaggcccagcagaagatggcagtggagggtctgctgtacccggatgaacacgcgacaggagccgtggcggctcttaaattcggcagccctgacatcactccggccttggatgtaaaggagtactactgccagctggctgagtgcctccagttcgagtgtggtgcggtctcttccgctctcgttcccagtggtgatggaaaacaactggaagtgggaggagctgtggggtcaacagtcaaagacccctcaaagataaaggacgtcagtgagctgaagatgctgatttcagagctgcaaaaggagctcgctgagctggagaagtgcaacgaggagctggagaacgaggtggagatgaagaaggctgcgtacatggaggagattgctgagctgcagtgtactatagatgaaatgcggcaccaggaggccgacttcgaagcgcagatgaaggagcagtgtgaagactacaaggtgctgctcagtgagaagatggccagagacatggaaatcactgcctacaggagtctggtggaggaagaggaggagaggctgtgcaacatttga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]