GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-19 02:00:32, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_069669877            1375 bp    mRNA    linear   VRT 15-NOV-2024
DEFINITION  PREDICTED: Semicossyphus pulcher vimentin-related 2 (vimr2), mRNA.
ACCESSION   XM_069669877
VERSION     XM_069669877.1
DBLINK      BioProject: PRJNA1182355
KEYWORDS    RefSeq.
SOURCE      Semicossyphus pulcher
  ORGANISM  Semicossyphus pulcher
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Labriformes; Labridae; Semicossyphus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_027211693) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_022749685.1-RS_2024_11
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 11/13/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1375
                     /organism="Semicossyphus pulcher"
                     /mol_type="mRNA"
                     /isolate="SPU_LCO1_2020_fin"
                     /db_xref="taxon:241346"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="fin"
                     /dev_stage="adult"
                     /lat_lon="34.04409 N 118.9339 W"
                     /collection_date="2020-08-26"
                     /collected_by="Giacomo Bernardi"
     gene            1..1375
                     /gene="vimr2"
                     /note="vimentin-related 2; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 3
                     Proteins"
                     /db_xref="GeneID:138598165"
     CDS             203..1375
                     /gene="vimr2"
                     /codon_start=1
                     /product="alpha-internexin"
                     /protein_id="XP_069525978.1"
                     /db_xref="GeneID:138598165"
                     /translation="
MAMLRVSSYRKLFEEDNWSKNGGMSVQCAGQSRASVRAKAVDDCDCDKLDFVAAKALNREGLSRFVQDRTVIAALNDRLVKLIQLAHCFEEENESLECQIVELEEKLSSRPASSGVTSTVAVPDYSLDAVVERLRRERDEILCDTEALHKELERLMTECEKAAQQRILQQQGQQDVAEEVDAVTAQCLALREQVAIYEEQLANMEAQQKMAVEGLLYPDEHATGAVAALKFGSPDITPALDVKEYYCQLAECLQFECGAVSSALVPSGDGKQLEVGGAVGSTVKDPSKIKDVSELKMLISELQKELAELEKCNEELENEVEMKKAAYMEEIAELQCTIDEMRHQEADFEAQMKEQCEDYKVLLSEKMARDMEITAYRSLVEEEEERLCNI"
     misc_feature    401..1360
                     /gene="vimr2"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:459643"
ORIGIN      
gttacgctgcgttttcgcgctcactcttcaggtacatatgaaatcgttactgtctgatgttcacgctattattggtcttctccttggcccgtgaaagatcttccacctcagtgctacattcttaatcatgtcaatataaaatccgcgtcttcgacctgctgccaccatttgtctgttgtgcagtttgaacccatccgaagccatggccatgctcagagtgtcgtcttaccgaaagctgtttgaggaggataactggagcaaaaatggagggatgagtgtacagtgtgcagggcagtcccgcgcctctgtcagggctaaagctgttgacgattgtgactgtgacaagttagactttgtagctgccaaggcgctcaacagggagggtctgagccgctttgtccaggaccgcaccgtcatcgctgccctcaacgaccgcctggtcaaacttattcaactggcccattgttttgaggaggagaatgagtctcttgaatgtcagattgtggagctagaggagaagctgagcagccgaccagcctcctccggcgtcacctccacagtcgcagtgcccgactacagtctggatgcagtggtggaaagactgcgtagggagagggatgagattctgtgtgacacagaggcgctgcacaaagagcttgaacgtctgatgacggagtgcgagaaggctgcacagcagaggatcctccaacagcagggacaacaggatgttgctgaggaagtggacgcggtgacagcacagtgtttggcgctgagggagcaagtggctatctatgaggagcagctggctaacatggaggcccagcagaagatggcagtggagggtctgctgtacccggatgaacacgcgacaggagccgtggcggctcttaaattcggcagccctgacatcactccggccttggatgtaaaggagtactactgccagctggctgagtgcctccagttcgagtgtggtgcggtctcttccgctctcgttcccagtggtgatggaaaacaactggaagtgggaggagctgtggggtcaacagtcaaagacccctcaaagataaaggacgtcagtgagctgaagatgctgatttcagagctgcaaaaggagctcgctgagctggagaagtgcaacgaggagctggagaacgaggtggagatgaagaaggctgcgtacatggaggagattgctgagctgcagtgtactatagatgaaatgcggcaccaggaggccgacttcgaagcgcagatgaaggagcagtgtgaagactacaaggtgctgctcagtgagaagatggccagagacatggaaatcactgcctacaggagtctggtggaggaagaggaggagaggctgtgcaacatttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]