GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-15 04:35:35, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_067888100            2643 bp    mRNA    linear   PLN 29-AUG-2024
DEFINITION  Phytophthora ramorum Protein argonaute PNH1 (KRP23_3271), partial
            mRNA.
ACCESSION   XM_067888100
VERSION     XM_067888100.1
DBLINK      BioProject: PRJNA1149793
            BioSample: SAMN19730089
KEYWORDS    RefSeq.
SOURCE      Phytophthora ramorum (sudden oak death agent)
  ORGANISM  Phytophthora ramorum
            Eukaryota; Sar; Stramenopiles; Oomycota; Peronosporales;
            Peronosporaceae; Phytophthora.
REFERENCE   1  (bases 1 to 2643)
  AUTHORS   Carleson,N.C., Press,C.M. and Grunwald,N.J.
  TITLE     High-Quality, Phased Genomes of Phytophthora ramorum Clonal
            Lineages NA1 and EU1
  JOURNAL   Mol Plant Microbe Interact 35 (4), 360-363 (2022)
   PUBMED   35285670
REFERENCE   2  (bases 1 to 2643)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (27-AUG-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2643)
  AUTHORS   Carleson,N.C., Press,C.M. and Grunwald,N.J.
  TITLE     Direct Submission
  JOURNAL   Submitted (19-JUL-2021) Horticultural Crops Research Unit, USDA,
            3420 NW Orchard Ave., Corvallis, OR 97330, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_027150649).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..2643
                     /organism="Phytophthora ramorum"
                     /mol_type="mRNA"
                     /isolate="Pr-102"
                     /host="Quercus agrifolia"
                     /db_xref="taxon:164328"
                     /chromosome="Unknown"
                     /mating_type="A2"
                     /geo_loc_name="USA: California"
                     /collection_date="2004"
                     /genotype="NA1"
     gene            <1..>2643
                     /locus_tag="KRP23_3271"
                     /db_xref="GeneID:94223917"
     CDS             1..2643
                     /locus_tag="KRP23_3271"
                     /codon_start=1
                     /product="Protein argonaute PNH1"
                     /protein_id="XP_067747374.1"
                     /db_xref="GeneID:94223917"
                     /translation="
MQLNVNYFGISLAAAPAEIFKYHVTVERSPDLQADSKYGPSGADQKDESMGDEPKQERKDDKDVVMAEPSADAPPKQEARPERPLPRTLVRNVINAALHQYEGEFGGLRVVHDGMTALYSPAMLPWTARDFADVNPDGPSATPAPPAPPPSADGAPRRSFRGPRTFVVKMKLVETISTSSLEDYYSNPEVNVMPVLQALDVVARHLGAQRLIAVGRNFFTMKKTHSLKGGKELCWGYHQAIRLADHKLLMNVDQAATVFYAPGPLMQLAMAALRARGPDEVRDLSERDMKSLARALRKIEVVPTHRKDRKRAIFGVSAKPADRTIVSIKGEDMSVAAYFIAKYNMKLRYPDLPLVNVGSKRPGKENWLPIEVCEVAPGQRCANINDLDTAEIIRQTSQPPRNRKENIMEQIRQAGFENDPFLAAFGVKVDQRLESTEARVMEAPEVQYQNVSERPAGGQWSLNAKKFVEGVPVRNWGVIVAANTSERDVRNFVGKLTDLGDQRGLPFEDKNPVLIHQDQYRGAQVEELMKMCHQELERRNMGPPQILMVILPAKNSPVYGDVKRMSDTVLGLPSQCIASVNLPRANPQFCANVCLKINMKLKGKNAVLRDSLPLVSTAPTIIIGADVEHPRSGMGGRPSIAAVVASMDRYSAQYAARVAAQKASSDIQQLPSMLRELFLAYYDNTKRKPEHVIYYRDGVSEGQMFDILQTEMRALRKAFKMISEDYNPPVTFVVVNKRHHLRAFPVNQRDADRKGNVMPGTVIDTGVVNPHRFDFFLYGHSGIQGTTVPGHYTVLHDENNMSAEDIQRLTYHLGYTFSRCTRSVSFVTPVYYAHLAAARARFYLNEGSDGASTVGSYNSNVSSFEFADVHSNVLNRMFYT"
     misc_feature    331..606
                     /locus_tag="KRP23_3271"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    637..780
                     /locus_tag="KRP23_3271"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    784..1128
                     /locus_tag="KRP23_3271"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    1258..2532
                     /locus_tag="KRP23_3271"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1675..1677,1687..1689,1723..1734,1741..1743,
                     1765..1767,1774..1776,1786..1788,1798..1800)
                     /locus_tag="KRP23_3271"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1876..1878,1882..1884,2089..2091,2500..2502)
                     /locus_tag="KRP23_3271"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atgcagctgaacgtcaactactttggcatctcgctcgccgcggccccggcggagattttcaaatatcatgtcacagttgaacgttcccccgacctgcaggcggactcaaagtatggtccttcgggcgccgaccaaaaagatgagagcatgggcgacgagccgaaacaagaacgaaaggatgacaaggacgttgtgatggccgagccatcggcagacgcgccgccaaagcaagaggcgagacccgaacgcccgttgcctcgtacactagtgcgcaacgtgattaacgcagcacttcaccaatacgaaggagaatttggaggtctgcgagtggtccacgacggcatgactgctctctattcgccggccatgctgccgtggactgcgagagatttcgcagacgttaacccggacggccccagtgccacaccggcacctcctgcaccacccccatcagctgacggcgcacctcgtcggagttttcgtggcccgaggacttttgtcgtcaagatgaagttggtggagaccatctccacgtccagtttggaggactattattccaacccggaggtgaacgttatgcctgttctccaggctcttgacgtggtggcacgtcatctcggtgctcaacgtctcattgctgtcgggcgtaacttctttacgatgaagaagacgcactcgctgaagggtggcaaggagctctgttggggctaccaccaagcgattcggctcgcagaccacaagctgctgatgaacgttgaccaagcagcaaccgtgttctacgcaccaggccctttgatgcagctcgctatggcagctctgcgggctcgtggccccgacgaagttcgcgacctgtcggagcgtgatatgaaatcgttggcacgcgcgctgcgcaagattgaggtggtgcctacgcaccgcaaagaccgcaagcgcgccattttcggggtgagtgccaagcctgctgaccggacgatagtgagcattaagggagaggacatgtccgttgctgcgtacttcattgccaagtacaacatgaaactgcgctatccggatctaccattggtgaacgttggcagcaagcgccctggaaaagaaaattggctgcccattgaggtttgcgaggttgctcctggacaacgttgcgccaacatcaacgacctggacacggcggaaatcattcgccagaccagtcagcctccgcgcaatcgcaaagagaatattatggagcaaattcgccaggcaggctttgagaacgacccgtttctggcggcatttggcgtcaaggtggaccaacgtcttgaatcaacggaagctcgcgtcatggaagcgcccgaagtccaataccagaatgtatcggagcgcccagcgggtggccagtggagtctcaatgcgaagaagttcgtcgagggtgttcctgttcgtaattggggagtgatcgttgcggctaataccagcgagcgcgacgtccgaaactttgttgggaagttgaccgacttgggagaccagcgtgggctcccatttgaggacaaaaatcccgtgctcatccaccaggaccagtaccgtggagcacaagtggaagagctcatgaaaatgtgccaccaagaactggagagacgaaacatgggcccaccacagatactcatggtgatcttgccggccaaaaactctcctgtttacggcgacgtcaagcgcatgtccgatacagtgctgggcctgccgagccaatgcattgcctctgtgaatcttcctcgagccaacccacaattctgcgcgaacgtgtgcctcaagatcaacatgaagctgaaaggaaagaacgcggtgctgcgtgactcgctcccactggttagcaccgcgcccacgataatcatcggagctgatgtggagcacccgcgctcgggcatgggtggccgtccgtccatcgctgccgttgtggcctccatggaccgctattcggcgcagtacgctgcgcgcgtggcagcgcaaaaggcctccagcgatattcaacagctcccaagtatgctgcgcgaactgttcctggcttattatgacaacaccaagcgcaaaccggagcacgtgatctactaccgcgatggagtgagcgagggccaaatgtttgacatcctgcagaccgaaatgcgggcgctacgcaaggcttttaagatgatatctgaggactacaaccctccagtcaccttcgtggtagtgaacaagcgccaccacctcagagcgttcccagtgaaccagcgtgatgccgaccgcaagggtaatgttatgcctggcacagtgatcgacaccggcgttgtgaacccgcatcgatttgactttttcctctacggccacagcggaatccagggcacgaccgtaccgggacattacacggtgctgcatgatgagaacaacatgtcggcggaggacattcaacgcctcacgtaccacctgggctacacgttctcgcgctgcactcgctccgtgtcgtttgtcactccggtttactatgcgcacttggctgcagcgcgtgctcgcttctatctgaacgagggctcggatggtgcctccacggtgggctcctacaactcgaacgtttccagcttcgagtttgctgacgtgcacagcaacgtcctcaaccgcatgttctacacttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]