LOCUS       XM_065952331            1524 bp    mRNA    linear   VRT 24-JUN-2024
DEFINITION  PREDICTED: Labrus bergylta probable inactive protein kinase
            DDB_G0270444 (LOC136178463), mRNA.
ACCESSION   XM_065952331
VERSION     XM_065952331.1
DBLINK      BioProject: PRJNA1126594
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Labrus bergylta (ballan wrasse)
  ORGANISM  Labrus bergylta
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Labriformes; Labridae; Labrus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_027077286) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_963930695.1-RS_2024_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/21/2024
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1524
                     /organism="Labrus bergylta"
                     /mol_type="mRNA"
                     /db_xref="taxon:56723"
                     /chromosome="Unknown"
     gene            1..1524
                     /gene="LOC136178463"
                     /note="probable inactive protein kinase DDB_G0270444;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 3 Proteins"
                     /db_xref="GeneID:136178463"
     CDS             1..1524
                     /gene="LOC136178463"
                     /codon_start=1
                     /product="probable inactive protein kinase DDB_G0270444"
                     /protein_id="XP_065808403.1"
                     /db_xref="GeneID:136178463"
                     /translation="

MRTSCRASCRTSCRTSCRTSCRTSCRTSCRTSLQDELQDELQDELQEEDELQDELQDELQDELQDELQDELQDEDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELQDELKDELKDELQDELQDELKDELQDELQDELQDELQDELQDELQDELKDELKDELQDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELKDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELQDELKDELQDELQDELQDEDELQDELKDELKDELQDELQDELQDELKDELQDELQDELQDELKDELKDELQQKLPCTP"

ORIGIN      

atgaggacgagctgcagggcgagctgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgagcttgcaggacgagttgcaggacgagctgcaggacgagctgcaggaagaggacgagttgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgagctgcaggacgaactgcaggacgaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaagacgagttgcaggacgagctgaaggacgagctgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagctgaaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagctgaaggacgagctgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagctgaaggacgagctgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagctgaaggacgagctgaaggacgagctgcaggacgagttgcaggacgagctgaaggacgagctgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagctgaaggacgagctgaaggacgagctgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagctgaaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgaactgcaggacgaactgcaggacgagttgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgagctgcaggacgagctgcaggacgaactgcaggacgagttgcaggacgagttgcaggacgagctgaaggacgagctgcaggacgagctgcaggacgaactgcaggacgagttgcaggacgaactgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagttgcaggacgaactgcaggacgagctgcaggacgagttgcaggacgagttgcaggacgagctgcaggacgagctgcaggacgagttgcaggacgagctgcaggacgagctgaaggacgagttgcaggacgagttgcaggacgagttgcaggatgaggacgagttgcaggacgagctgaaggacgagctgaaggacgagttgcaggacgagttacaggacgaactgcaggacgagctgaaggacgagttgcaggacgagttgcaggacgaactgcaggacgagctgaaggacgagctgaaggacgagttgcaacagaagctcccctgcactccataa

//