LOCUS       XM_054372066             651 bp    mRNA    linear   PRI 26-AUG-2024
DEFINITION  PREDICTED: Homo sapiens microsomal glutathione S-transferase 1
            (MGST1), transcript variant X5, mRNA.
ACCESSION   XM_054372066
VERSION     XM_054372066.1
DBLINK      BioProject: PRJNA807723
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_060936) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_009914755.1-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/23/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..651
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /isolate="CHM13"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /sex="female"
                     /cell_line="CHM13htert"
                     /tissue_type="hydatidiform mole"
                     /note="haploid cell line"
     gene            1..651
                     /gene="MGST1"
                     /gene_synonym="GST12; MGST; MGST-I; PMAN"
                     /note="microsomal glutathione S-transferase 1; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 1 mRNA, 5 long SRA reads, 1 Protein, and 88% coverage
                     of the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:4257"
                     /db_xref="HGNC:HGNC:7061"
                     /db_xref="MIM:138330"
     CDS             144..587
                     /gene="MGST1"
                     /gene_synonym="GST12; MGST; MGST-I; PMAN"
                     /codon_start=1
                     /product="microsomal glutathione S-transferase 1 isoform
                     X2"
                     /protein_id="XP_054228041.1"
                     /db_xref="GeneID:4257"
                     /db_xref="HGNC:HGNC:7061"
                     /db_xref="MIM:138330"
                     /translation="

MVDLTQVMDDEVFMAFASYATIILSKMMLMSTATAFYRLTRKVFANPEDCVAFGKGENAKKYLRTDDRVERVRRAQEILGPERQIQKNLHVNETGVEMRMAGNAWKQTCNCLMAWSSKSQRMECNGMISAHRNLCLPDSSDSPASAS"

     misc_feature    189..>371
                     /gene="MGST1"
                     /gene_synonym="GST12; MGST; MGST-I; PMAN"
                     /note="MAPEG family; Region: MAPEG; cl45926"
                     /db_xref="CDD:480267"
ORIGIN      

ggcagatggaagacttgggggggtctctgccagctggaagtgcttggctccacttagcagctaaacttagcttttcaatcgatcgcttttgaaagggaattgtatttctgtccccgtgcggattccagaccaaaattgaaaaaatggttgacctcacccaggtaatggatgatgaagtattcatggcttttgcatcctatgcaacaattattctttcaaaaatgatgcttatgagtactgcaactgcattctatagattgacaagaaaggtttttgccaatccagaagactgtgtagcatttggcaaaggagaaaatgccaagaagtatcttcgaacagatgacagagtagaacgtgtacgcagggcacaggagatcttaggcccagaaaggcagattcagaagaacctacatgtaaatgagactggagtggaaatgagaatggcaggaaatgcatggaaacagacttgtaactgtctcatggcctggtcgtccaaatcccagaggatggagtgcaatggcatgatctcagctcaccgcaacctctgcctcccggattcaagtgattctcctgcctcagcctcttgagtagctgggattacaggttgctgcagaagtcaagagctaaccaagaagacaaggaatgtaacat

//